Preview

Вавиловский журнал генетики и селекции

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 18, № 2 (2014) ИДЕНТИФИКАЦИЯ ПОЛНОРАЗМЕРНЫХ ГЕНОМОВ ЭНДОГЕННЫХ РЕТРОВИРУСОВ У СИБИРСКИХ МИНИ-СВИНЕЙ Аннотация  PDF (Rus)  похожие документы
Р. Б. Айтназаров, Н. С. Юдин, С. В. Никитин, В. И. Ермолаев, М. И. Воевода
"... of endogenous pig retroviruses is reported. Currently, the frequency of carriers of types A, B, and C of PERV ..."
 
Том 20, № 6 (2016) Определение числа копий эндогенных ретровирусов типа А у домашних свиней и диких кабанов Аннотация  PDF (Rus)  похожие документы
Р. Б. Айтназаров, Н. С. Юдин, Р. С. Кирильчук, Н. Н. Кочнев, С. П. Князев, М. И. Воевода
"...  and to the anatomical and physiological similarity to humans, the pig is the best source of xenografts. The pig genome ..."
 
Том 21, № 7 (2017) Ассоциация числа копий эндогенных ретровирусов типа А с гематологическими показателями и полом у мини-свиней Аннотация  похожие документы
Р. Б. Айтназаров, С. В. Никитин, Г. В. Концевая, М. И.  Воевода, Н. С. Юдин
"... Pig is the most promising species for transplantation of organs and cells into humans, although ..."
 
Том 20, № 5 (2016) Полиморфизм локусов масти у мини-свиней Аннотация  PDF (Rus)  похожие документы
С. В. Никитин, К. С. Шатохин, С. П. Князев, Г. М. Гончаренко, В. И. Запорожец, В. И. Ермолаев
"... in a breeding group of mini-pig in the Institute of Cytology and Genetics of the Siberian Branch of the Russian ..."
 
Том 21, № 6 (2017) Ювенильные окраски мини-свиней селекции ИЦиГ СО РАН Аннотация  PDF (Rus)  похожие документы
С. В. Никитин, С. П. Князев, К. С. Шатохин, Г. М. Гончаренко, В. И. Запорожец, В. И. Ермолаев
"... of the suit, wild type agouti pigs of the species Sus scrofa L. However, in ICG mini pigs, in addition ..."
 
Том 22, № 8 (2018) Разведение и селекция мини-свиней ИЦиГ СО РАН Аннотация  PDF (Rus)  похожие документы
С. В. Никитин, С. П. Князев, К. С. Шатохин, В. И. Запорожец, В. И. Ермолаев
"... The article considers methods used for breeding and selection of mini-pigs in the ICG, SB RAS ..."
 
Том 21, № 7 (2017) Особенности распределения электролитов в различных тканях у миниатюрных свиней Аннотация  PDF (Rus)  похожие документы
А. В. Фатьянова, В. А. Лавриненко, О. В. Трапезов, Н. С. Юдин
"... Striking similarities between human and miniature pig anatomy and physiology of the cardiovascular ..."
 
Том 18, № 2 (2014) МИНИАТЮРНЫЕ СВИНЬИ ИЦиГ – МОДЕЛЬНЫЙ ОБЪЕКТ ДЛЯ ИЗУЧЕНИЯ ФОРМООБРАЗОВАТЕЛЬНОГО ПРОЦЕССА Аннотация  PDF (Rus)  похожие документы
С. В. Никитин, С. П. Князев, К. С. Шатохин
"... собой эта группа животных в настоящее время и какими уникальными (по сравнению с другими мини-свиньями ..."
 
Том 19, № 5 (2015) Разнонаправленный половой диморфизм по живой массе у домашних свиней Аннотация  PDF (Rus)  похожие документы
С. В. Никитин, С. П. Князев, К. С. Шатохин, Г. М. Гончаренко, В. И. Ермолаев
"... of variation of 81%). However, there are three genealogically continuous groups of domestic pigs (Vietnamese ..."
 
Том 19, № 6 (2015) Оценка роли однонуклеотидного полиморфизма в гене лимфотоксина бета при доместикации свиньи на основе биоинформационного и экспериментального подходов Аннотация  PDF (Rus)  похожие документы
Р. Б. Айтназаров, Е. В. Игнатьева, Н. Э. Базарова, В. Г. Левицкий, С. П. Князев, Я. Гон, Н. С. Юдин
"... beta (LTB) cytokine in pigs of domestic breeds and wild boars; 2) investigation of the expression ..."
 
Том 19, № 5 (2015) Факторы изменчивости мотивированной страхом реакции удаления от человека у мини-свиней селекции ИЦиГ СО РАН Аннотация  PDF (Rus)  похожие документы
В. С. Ланкин, С. В. Никитин, О. В. Трапезов
"... У четырех смежных поколений мини-свиней, созданных в ИЦиГ СО РАН, изучали реакцию удаления от ..."
 
Том 17, № 3 (2013) ГЕНОТИПИЧЕСКАЯ И МОДИФИКАЦИОННАЯ ИЗМЕНЧИВОСТЬ ПАССИВНО-ОБОРОНИТЕЛЬНОГО ПОВЕДЕНИЯ ДОМАШНИХ СВИНЕЙ ПО ОТНОШЕНИЮ К ЧЕЛОВЕКУ Аннотация  PDF (Rus)  похожие документы
В. С. Ланкин
"... of the passive response to humans in specialized crossbred pigs: Laconi, paternal line, and unique sino-european ..."
 
Том 22, № 8 (2018) Пути совершенствования генофонда свиней Российской Федерации Аннотация  PDF (Rus)  похожие документы
В. А. Бекенёв
"... An analysis of the system of breeding work in the pig industry of our country has been carried out ..."
 
Том 23, № 5 (2019) Биотехнологические основы получения клонированных эмбрионов свиней Аннотация  похожие документы
А. В. Лопухов, Г. Н. Сингина, Н. А. Зиновьева
"... reproduction, which is both a direct offspring and a genetic copy of the parent organism. To date, the pig ..."
 
Том 18, № 2 (2014) ВАРИАЦИЯ МАССЫ НОВОРОЖДЕННОЙ ОСОБИ У ДОМАШНИХ СВИНЕЙ И ПРОЦЕСС АДАПТАЦИИ Аннотация  PDF (Rus)  похожие документы
С. Н. Никитин, С. П. Князев, В. И. Ермолаев
"... This article shows that weight dynamics in newborn domestic pig individuals reflects adaptive ..."
 
Том 21, № 5 (2017) Роль условий среды пренатального роста плодов в формировании массы новорожденной особи у домашних свиней Аннотация  PDF (Rus)  похожие документы
С. В. Никитин, С. П. Князев, В. И. Ермолаев
"... The weight of newborn piglets in domestic pigs depends on the maternal environment. Using ..."
 
Том 18, № 2 (2014) РОЛЬ ПОЛИМОРФИЗМА ГЕНА PANE1 В ФОРМИРОВАНИИ РЕПРОДУКТИВНЫХ ПОКАЗАТЕЛЕЙ У СВИНЕЙ Аннотация  PDF (Rus)  похожие документы
Н. С. Юдин, Р. Б. Айтназаров, С. П. Князев, В. А. Бекенев, Ю. В. Подоба, А. Б. Бердибаева, М. И. Воевода
"... with immunological blood indices and negatively associated with birthweight in Landrace pigs (Huang et al., 2010 ..."
 
Том 22, № 4 (2018) ИССЛЕДОВАНИЕ ВЛИЯНИЯ ГИПОТЕРМИЧЕСКОЙ КОНСЕРВАЦИИ НА УРОВЕНЬ НАТРИЯ В КЛЕТКАХ ЭНДОТЕЛИЯ ТРАНСПЛАНТАТА РОГОВИЦЫ Аннотация  PDF (Rus)  похожие документы
Г. С. Батурина, И. Г. Пальчикова, А. А. Конев, Е. С. Смирнов, Л. Е. Каткова, Е. И. Соленов, И. А. Искаков
"... the intracellular sodium concentration in cornea endothelial cells in samples of pig cornea that underwent ..."
 
Том 17, № 3 (2013) ГЕНЕТИЧЕСКИЙ И МОЛЕКУЛЯРНЫЙ АНАЛИЗ КОМПЛЕМЕНТАЦИИ ЛОКУСОВ FLAMENCO И PIWI У DROSOPHILA MELANOGASTER Аннотация  PDF (Rus)  похожие документы
Ф. А. Урусов, Л. Н. Нефедова, А. Р. Лавренов, Н. И. Романова, А. И. Ким
"... транспозиции ретротранспозона/ретровируса gypsy, является одним из источников антисмысловых РНК ..."
 
Том 17, № 4/2 (2013) СТВОЛОВЫЕ КЛЕТКИ И ГЕНЕТИЧЕСКОЕ РЕПРОГРАММИРОВАНИЕ Аннотация  PDF (Rus)  похожие документы
С. Л. Киселев, М. А. Лагарькова
"... с изменен- ным геномом и не подверженный африканской свиной лихорадке (http://www ..."
 
Том 18, № 1 (2014) ГЕНЕТИКА ДОМАШНИХ И СЕЛЬСКОХОЗЯЙСТВЕННЫХ МЛЕКОПИТАЮЩИХ Аннотация  PDF (Rus)  похожие документы
Д. М. Ларкин
"... пример связан с тем, как эволю- ционные изменения в геноме свиньи сделали этот вид животных ..."
 
Том 20, № 6 (2016) От редактора Аннотация  PDF (Rus)  похожие документы
Н. А. Колчанов
"... данных, а также оригинальную работу по геном- ному ана лизу эндогенных ретровирусов у домаш них свиней ..."
 
Том 17, № 4/2 (2013) ТРАНСГЕННЫЕ ЖИВОТНЫЕ: ФУНДАМЕНТАЛЬНЫЕ И ПРИКЛАДНЫЕ АСПЕКТЫ Аннотация  PDF (Rus)  похожие документы
О. Л. Серов
"... , следовательно, лишена возможности «включиться» в ее геном. Исключением являются ретровирусы, способные ..."
 
Том 17, № 4/1 (2013) КОМПЬЮТЕРНЫЙ АНАЛИЗ СТРУКТУРЫ ЛИПАЗ БАКТЕРИЙ pода Geobacillus И ВЫЯВЛЕНИЕ МОТИВОВ, ВЛИЯЮЩИХ НА ИХ ТЕРМОСТАБИЛЬНОСТЬ Аннотация  PDF (Rus)  похожие документы
К. Н. Сорокина, М. А. Нуриддинов, А. С. Розанов, В. А. Иванисенко, С. Е. Пельтек
"... группы липаз с высокой термостабильностью (со временем полуинактивации свыше 1000 мин): V198A, Q203E, V ..."
 
Том 18, № 2 (2014) ОТБОР ПО ПОВЕДЕНИЮ И СОСТОЯНИЕ СИСТЕМ МАКРОГЛОБУЛИНОВ И ЛИПОПРОТЕИНОВ У АМЕРИКАНСКОЙ НОРКИ (NEOVISON VISON) Аннотация  PDF (Rus)  похожие документы
В. И. Ермолаев, М. А. Савина, Н. С. Юдин, Р. Б. Айтназаров, С. В. Никитин, Л. И. Трапезова, О. В. Трапезов
"... видов млекопитающих, в том числе свиньи (Yermolaev et al., 2013). Можно предположить, что у норки этот ..."
 
Том 19, № 4 (2015) Межлинейные различия мышей по температурной реакции на интраназальное введение наночастиц оксида платины Аннотация  PDF (Rus)  похожие документы
Д. В. Петровский, А. В. Ромащенко, С. Ю. Троицкий, М. П. Мошкин
"... животного, что вкупе с данными по динамике снижения температуры (max Δtтела ~ 80–100 мин) позволяет ..."
 
Том 21, № 7 (2017) Эффективность ольфакторного транспорта аморфных и кристаллических наночастиц оксидов марганца Аннотация  PDF (Rus)  похожие документы
А. В. Ромащенко, Д. В. Петровский, М. Б. Шарапова, Ю. М. Мошкин, К. Э. Купер, К. Н. Морозова, Е. В. Киселева, М. П. Мошкин
"... преодолевать мукозальный слой, покрывающий ОЭ. Действительно, введение муколитика (дитиотреитол) за 20 мин до ..."
 
Том 20, № 4 (2016) Система CRISPR/Cas9 – универсальный инструмент геномной инженерии Аннотация  PDF (Rus)  похожие документы
А. В. Смирнов, А. М. Юнусова, В. А. Лукьянчикова, Н. Р. Баттулин
"... ) до мутагенеза 62 копий гена pol в эндогенных ретровирусах из генома свиньи (Yang et al., 2015 ..."
 
Том 20, № 6 (2016) Зачем нужны коллекции линий клеток Аннотация  PDF (Rus)  похожие документы
А. Г. Мензоров, О. Л. Серов
"... того, необходима разработка стандартов культивирования и хранения клеток этого типа. В мини-обзоре ..."
 
Том 19, № 3 (2015) Модулирующее действие мутаций генов, затрагивающих окраску волосяного покрова, на генерацию и нейтрализацию активных форм кислорода. Американская норка (Neovison vison) как модель Аннотация  PDF (Rus)  похожие документы
С. Н. Сергина, В. А. Илюха, И. В. Баишникова, Т. Н. Ильина
"... выражали в количестве мкмоль Н2О2, разложенной за 1 мин. Содер- жание восстановленного глутатиона (GSH ..."
 
Том 18, № 1 (2014) ГЕНОТИПЫ МЛЕКОПИТАЮЩИХ ДЛЯ БИОМЕДИЦИНСКИХ ИССЛЕДОВАНИЙ Аннотация  PDF (Rus)  похожие документы
М. П. Мошкин
"... разработаны стандарт- ные протоколы фенотипирования, которые поз- воляют за 15 мин получить несколько десятков ..."
 
Том 19, № 4 (2015) Использование модели половой активации для фенотипирования самцов линий мышей и крыс с закрепленными селекцией нарушениями поведения Аннотация  PDF (Rus)  похожие документы
М. А. Тихонова, Т. Г. Амстиславская
"... течение 10 мин, а также гормональной активации, которую можно определить по подъему уровня тестостерона ..."
 
Том 19, № 6 (2015) От редактора Аннотация  PDF (Rus)  похожие документы
Н. А. Колчанов, Н. Л. Подколодный
"... однонук- леотидных полиморфизмов в генах при доместикации свиньи. Раздел «Биоинформатика растений ..."
 
Том 20, № 6 (2016) Исследование влияния электромагнитного излучения терагерцового диапазона на протеом экстремофильной археи Halorubrum saccharovorum Аннотация  PDF (Rus)  похожие документы
Т. Н. Горячковская, С. Г. Константинова, И. А. Мещерякова, С. В. Банникова, Е. А. Демидов, А. В. Брянская, М. А. Щеглов, А. И. Семенов, Д. Ю. Ощепков, В. М. Попик, С. Е. Пельтек
"... ) с модификациями. Клетки осаждали центрифугированием при 5 900 g в течение 15 мин. Полученный ..."
 
Том 19, № 4 (2015) Сравнение различных сочетаний криопротекторов и методов оттаивания при криоконсервации эмбрионов мышей и крыс Аннотация  PDF (Rus)  похожие документы
Т. Н. Игонина, Е. Ю. Брусенцев, И. Н. Рожкова, В. А. Напримеров, С. Я. Амстиславский
"... ), охлаждали в соответствии со следующей программой: от 18 °С до –7 °C со скоростью –1 °С/мин; 10 мин при –7 ..."
 
Том 19, № 4 (2015) Возможности высокотехнологичного фенотипирования методом спектроскопии ЯМР на примере метаболического отклика печени крыс на воздействие алкоголя и Рейши Аннотация  PDF (Rus)  похожие документы
М. С. Крестина, О. Б. Шевелев, И. В. Коптюг, Л. А. Герлинская, С. Е. Пельтек, А. Е. Акулов
"... ); 2) обработка ультразвуком (ультразвуковой прибор QSonica q700, 300 Вт, 5 мин); 3) пере- мешивание ..."
 
Том 19, № 4 (2015) Вклад кишечного муцина-2 в эффективность антибактериальной терапии Helicobacter spp. у лабораторных мышей Аннотация  PDF (Rus)  похожие документы
Е. А. Литвинова, М. Д. Беляев, А. В. Прохорчук, В. С. Коростина, Е. Б. Прохорчук, Е. Н. Кожевникова
"... способом: образец гомогенезировали ин- кубированием 10 мин при температуре 65 °С в 500 мкл буфера 50 мМ ..."
 
Том 18, № 1 (2014) ВВЕДЕНИЕ В МОЛЕКУЛЯРНУЮ ВИРУСОЛОГИЮ Аннотация  PDF (Rus)  похожие документы
С. В. Нетёсов, Н. А. Маркович
"... определен Inoviridae (M13) Parvoviridae (парвовирус В19) Circoviridae (патогены свиней) Таблица 2 РНК ..."
 
Том 21, № 1 (2017) Оценка разнообразия растений и изменчивости транскрипционной активности с использованием молекулярных маркеров на основе ретротранспозонов Аннотация  похожие документы
Р. Н. Календарь, К. С. Айжаркын, О. Н. Хапилина, А. А. Аменов, Д. С. Тагиманова
"... derivatives) for LTR retrotransposons (Kalendar et al., 2004, 2008). Retrotransposons and retroviruses share ..."
 
Том 19, № 4 (2015) Эффекты воздействия факторов роста при культивировании in vitro эмбрионов мышей и крыс Аннотация  PDF (Rus)  похожие документы
Е. Ю. Брусенцев, Т. Н. Игонина, И. Н. Рожкова, Д. С. Рагаева, С. Я. Амстиславский
"... следующей программой: от 18 °С до –7 °C со скоростью –1 °С/мин; 10 мин при –7 °С, сидинг (путем ..."
 
Том 19, № 4 (2015) Эффекты репродуктивных технологий и SPF‑статуса на некоторые физиологические и поведенческие характеристики крыс с артериальной гипертензией (линия НИСАГ) Аннотация  PDF (Rus)  похожие документы
Д. С. Рагаева, Т. О. Абрамова, И. Н. Рожкова, Е. Ю. Брусенцев, Е. В. Калиниченко, Т. Н. Игонина, С. Я. Амстиславский
"... –7 °C со скоростью –1 °С/мин; 10 мин при –7 °С, сидинг через 1 мин; от –7 °С до –35 °С со скоростью ..."
 
Том 19, № 4 (2015) Поведенческое фенотипирование мышей с нокаутом по фактору некроза опухоли Аннотация  PDF (Rus)  похожие документы
Д. В. Фурсенко, Н. В. Хоцкин, В. А. Куликов, А. В. Куликов
"... свободно исследовать пространство в течение 5 мин. Автоматически оценивали общий прой- денный путь (см) и ..."
 
Том 19, № 4 (2015) Роль генов Mucin-2 и Kaiso в социальном поведении мышей Аннотация  PDF (Rus)  похожие документы
Е. Н. Кожевникова, К. М. Ачасова, В. С. Коростина, Е. Б. Прохорчук, Е. А. Литвинова
"... (18 дн.) самцы линии Balb/cJ на 2 мин. �ерез 90 мин эти же животные были подсажены снова на 5 мин. Во ..."
 
Том 19, № 4 (2015) Поведенческое фенотипирование мышей с нокаутом гена Kaiso Аннотация  PDF (Rus)  похожие документы
В. С. Коростина, А. В. Куликов
"... трассировались в течение 5 мин. Автоматически оценивали пройденный путь (см) и вре- мя (%), проведенное в ..."
 
Том 16, № 1 (2012) РАСПРЕДЕЛЕНИЕ АЛЛЕЛЕЙ ГЕНОВ Wx В КОЛЛЕКЦИИ МЯГКОЙ ПШЕНИЦЫ КРАСНОДАРСКОГО НИИСХ им. П.П. ЛУКЬЯНЕНКО Аннотация  PDF (Rus)  похожие документы
М. В. Климушина, Н. И. Гладких, М. Г. Дивашук, Л. А. Беспалова, А. В. Васильев, Г. И. Карлов
"... (Nakamura et al., 2002) 95 ºC – 5 мин; 32 цикла: 95 ºC – 30 с, 65 ºC – 30 с, 72 ºC – 2 мин; 1 цикл: 72 ºC ..."
 
Том 19, № 2 (2015) Генетический контроль признаков, связанных с усвоением фосфора у сортов риса (Oryza sativa L.) Аннотация  PDF (Rus)  похожие документы
Ю. К. Гончарова, Е. М. Харитонов
"... ). Параметры ПЦР, использованные в данном экспе- рименте: 5 мин при 94 °С – начальная денатурация, следу- ющие ..."
 
Том 21, № 4 (2017) Об отборе лисиц на агрессивность и его коррелированных последствиях Аннотация  PDF (Rus)  похожие документы
Л. Н. Трут, А. В. Харламова, А. В. Владимирова, Ю. Э. Гербек
"... час (с 7 ч 09 мин до 7 ч 58 мин). Принципиально важно, что через 15 по- table 5. Aggressiveness ..."
 
Том 19, № 3 (2015) Рецептор глюкокортикоидов: переход из цитоплазмы в клеточное ядро, хроматиновый и внутриядерный шапероновый циклы Аннотация  PDF (Rus)  похожие документы
В. М. Меркулов, Н. В. Климова, Т. И. Меркулова
"... полуперехода 3–5 мин), тогда как выход этого белка из ядер занимает несколько часов, т. е. ГР находится в ..."
 
Том 21, № 4 (2017) «Синдром одомашнивания» в свете геномных данных Аннотация  похожие документы
А. С. Уилкинс
"... ) and pigs (Rubin et al., 2012). Altogether, these findings support the NCCH. As the authors say ..."
 
Том 19, № 3 (2015) Профиль экспрессии длинных и коротких РНК в цитоплазме и ядрах растущих ооцитов домашней курицы (Gallus gallus domesticus) Аннотация  PDF (Rus)  похожие документы
А. В. Красикова, А. В. Федоров
"... модификациями, а именно после лизиса в TRIzol экстракт дополнительно центрифугирова- ли при 12 тыс. об/мин в ..."
 
Том 19, № 4 (2015) Исследование методом функциональной магнитно-резонансной томографии нейрональной реакции на запаховые стимулы у контрольных и ЛПС-стимулированных мышей Аннотация  PDF (Rus)  похожие документы
А. Е. Акулов, А. В. Ромащенко, О. Б. Шевелев, Д. В. Петровский, А. А. Савелов, М. П. Мошкин
"... запахи была исследована на фоне актива- ции врожденного иммунного ответа (введение ЛПС). За 10 мин до ..."
 
Том 16, № 4/2 (2012) ПОЛИМОРФИЗМ ПО ГЕНАМ СОМАТОТРОПИНА, ПРОЛАКТИНА, ЛЕПТИНА, ТИРЕОГЛОБУЛИНА БЫКОВ-ПРОИЗВОДИТЕЛЕЙ Аннотация  PDF (Rus)  похожие документы
С. В. Тюлькин, Т. М. Ахметов, Э. Ф. Валиуллина, Р. Р. Вафин
"... смешивали с 1 мл дистиллированной воды и центрифуги- ровали при 10 тыс. об/мин в течение 10 мин ..."
 
Том 21, № 4 (2017) Эволюция альтруизма Аннотация  похожие документы
Л. А. Дугаткин
"... ). Flack et al. (2006) used SNA to examine policing in male pig-tailed macaques (Macaca nemestrina ..."
 
Том 17, № 4/2 (2013) ПОПУЛЯЦИОННО-ГЕНЕТИЧЕСКИЕ ОСНОВЫ СОХРАНЕНИЯ ГЕНОФОНДОВ ДОМЕСТИЦИРОВАННЫХ ВИДОВ ЖИВОТНЫХ Аннотация  PDF (Rus)  похожие документы
Ю. А. Столповский
"... рогатого ско- та (35), гусей (25), свиней (22), американских норок (15). Доля исконно российских пород ..."
 
Том 17, № 3 (2013) АЛЛЕЛЬНЫЕ ВАРИАНТЫ WAXY-ГЕНОВ СОРТОВ ПШЕНИЦЫ МЯГКОЙ, ВОЗДЕЛЫВАЕМЫХ В ПЕРМСКОМ КРАЕ И В РЕСПУБЛИКЕ БАШКОРТОСТАН Аннотация  PDF (Rus)  похожие документы
И. В. Бобошина, С. В. Боронникова
"... 95 °C – 5 мин; 32 цикла: 95 °С – 30 с, 65 °С – 30 с, 72 °С – 2 мин; 1 цикл: 72 °С – 7 мин Wx-A1b-F ..."
 
Том 18, № 3 (2014) ПРИМЕНЕНИЕ ЭЛЕКТРОФОРЕЗА ЗАПАСНЫХ БЕЛКОВ СЕМЯДОЛЕЙ И ISSR-МАРКЕРОВ ДЛЯ ИДЕНТИФИКАЦИИ ГИБРИДОВ МЕЖДУ SORBUS SIBIRICA HEDL. И SORBOCOTONEASTER POZDNJAKOVII POJARK. Аннотация  PDF (Rus)  похожие документы
С. В. Асбаганов, Е. В. Кобозева, А. В. Агафонов
"... снова встряхива- ли на вортексе 2–3 с и центрифугировали при 13 000 об/мин 5 мин. Экстракт разделялся ..."
 
Том 19, № 5 (2015) Полиморфизм гена TRPM8 в кыргызской популяции: возможная связь с высокогорной адаптацией Аннотация  PDF (Rus)  похожие документы
В. Н. Бабенко, Ж. Т. Исакова, Э. Т. Талайбекова, Д. А. Асамбаева, В. Ф. Кобзев, Т. А. Потапова, М. И. Воевода, А. А. Алдашев
"... ­ ми: денатурация при 95 °С 1 мин, отжиг 1 мин (темпера­ тура отжига для каждого ОНП указана в табл. 3 ..."
 
Том 19, № 5 (2015) Влияние типов цитоплазматической мужской стерильности на содержание хлорофилла в листьях гибридов зернового сорго Аннотация  PDF (Rus)  похожие документы
О. П. Кибальник, Л. А. Эльконин
"... ­2164­15­322 Kibalnik O.P., Elkonin L.A. Effect of sterile cytoplasm types on pig­ ment content in F1 grain sorghum ..."
 
Том 19, № 3 (2015) Маркер-контролируемое выявление генотипов кукурузы с улучшенным качеством белка Аннотация  PDF (Rus)  похожие документы
О. А. Орловская, С. В. Кубрак, С. И. Вакула, Л. В. Хотылева, А. В. Кильчевский
"... нанесением в гель прогревали 5 мин при 100 °С. Электрофорез прово- дили в кислом ацетат-глициновом буфере ..."
 
Том 17, № 4/2 (2013) МОЛЕКУЛЯРНЫЕ МАРКЕРЫ В ГЕНЕТИЧЕСКИХ ИССЛЕДОВАНИЯХ И В СЕЛЕКЦИИ Аннотация  PDF (Rus)  похожие документы
Е. К. Хлесткина
"... , земляника, репа, картофель (2011); свинья, як, ячмень, банан, томат (2012). Рис. 6. Схема подхода ..."
 
Том 20, № 6 (2016) Методы маркирования клеток для изучения судьбы клеточных поколений Аннотация  PDF (Rus)  похожие документы
А. М. Юнусова, Н. Р. Баттулин
"... . Сайты интеграций ретровирусов как метки Ретровирусы представляют собой семейство РНК-содер- жащих ..."
 
Том 18, № 4/1 (2014) ИСПОЛЬЗОВАНИЕ МОЛЕКУЛЯРНЫХ МАРКЕРОВ В СЕЛЕКЦИИ ПШЕНИЦЫ НА УСТОЙЧИВОСТЬ К БУРОЙ РЖАВЧИНЕ В КРАСНОДАРСКОМ НИИСХ им. П.П. ЛУКЬЯНЕНКО Аннотация  PDF (Rus)  похожие документы
Э. Р. Давоян, Л. А. Беспалова, Р. О. Давоян, Ю. С. Зубанова, Д. С. Миков, В. А. Филобок, Ж. Н. Худокормова
"... umbellulata FJ13/1 94 °С – 6 мин; 35 циклов (92 °С – 30 с, 63 °С – 30 с, 72 °С – 60 с); 72 °С – 5 мин 1100 ..."
 
Том 19, № 2 (2015) Внутрисуточный ритм секреции глюкокортикоидов и динамика генного ответа Аннотация  PDF (Rus)  похожие документы
В. М. Меркулов, Н. В. Климова, Т. И. Меркулова
"... полужизни его мРНК (менее 30 мин, Hardin et al., 1992). Можно ожидать, что для других индуцируемых ..."
 
Том 16, № 4/1 (2012) RatDNA: БАЗА ДАННЫХ МИКРОЧИПОВЫХ ИССЛЕДОВАНИЙ НА КРЫСАХ ДЛЯ ГЕНОВ, АССОЦИИРОВАННЫХ С ЗАБОЛЕВАНИЯМИ СТАРЕНИЯ Аннотация  PDF (Rus)  похожие документы
О. С. Кожевникова, М. К. Мартыщенко, М. А. Генаев, Е. Е. Корболина, Н. А. Муралева, Н. Г. Колосова, Ю. Л. Орлов
"... response to amyloid-beta stimulation of cultured human retinal pig- ment epithelial cells // Invest ..."
 
Том 19, № 4 (2015) Модель искусственного метастазирования эпидермоидной карциномы человека А431 на мышах линии nude для исследования онколитической активности вируса осповакцины Аннотация  PDF (Rus)  похожие документы
Г. В. Кочнева, А. А. Гражданцева, Г. Ф. Сиволобова, А. В. Ткачева, А. Н. Швалов, А. Ю. Юнусова, Е. И. Рябчикова, С. В. Нетесов
"... antisense 20 п.н. 5′ ttctgtgagcgtatggcaaa 3′. Условия проведения ПЦР: 94 ° – 2 мин – 1 цикл, 94 ° – 10 ..."
 
Том 19, № 4 (2015) Репродуктивные эффекты нокаута гена фактора некроза опухолей (TNF) у мышей Аннотация  PDF (Rus)  похожие документы
С. О. Масленникова, Г. В. Концевая, М. А. Золотых, М. В. Анисимова, Н. А. Феофанова, М. П. Мошкин, С. А. Недоспасов, Л. А. Герлинская
"... местного времени) подсаживали двух самок и в течение 10 мин вели видеозапись их поведенческих ..."
 
Том 18, № 1 (2014) «РАЗОРВАННЫЕ» ГЕНЫ И СПЛАЙСИНГ Аннотация  PDF (Rus)  похожие документы
Г. М. Дымшиц, О. В. Саблина
"... . Исследования показывают, что интроны, ретротранспозоны и ретровирусы фи- логенетически связаны друг с другом и ..."
 
Том 16, № 2 (2012) ИНТЕРНАЛИЗАЦИЯ ЭКЗОГЕННОЙ ДНК ВО ВНУТРЕННИЕ КОМПАРТМЕНТЫ КЛЕТОК КОСТНОГО МОЗГА МЫШЕЙ Аннотация  PDF (Rus)  похожие документы
Е. В. Долгова, В. П. Николин, Н. А. Попова, А. С. Проскурина, К. Е. Орищенко, Е. А. Алямкина, Я. Р. Ефремов, Е. Р. Черных, А. А. Останин, Е. М. Малкова, О. С. Таранов, В. А. Рогачев, С. В. Сидоров, С. С. Богачев, М. А. Шурдов
"... специфических фрагмен- тов генома использовали следующий темпера- турный режим: 94 °С – 2 мин – 1 цикл, (94 °С ..."
 
Том 18, № 3 (2014) БИОТЕХНОЛОГИЧЕСКИЕ АСПЕКТЫ БИОСИНТЕЗА ЭТАНОЛА ИЗ МИСКАНТУСА Аннотация  PDF (Rus)  похожие документы
О. В. Байбакова, Е. А. Скиба
"... испарителя 190 °С, выдержка пробы при температуре 77 °С длитель- ностью 6 мин 30 с, затем – нагрев со ..."
 
Том 17, № 2 (2013) ХАРАКТЕРИСТИКА ИЗМЕНЕНИЯ КОЛИЧЕСТВА УМЕРЕННЫХ ПОВТОРОВ В ГЕНОМЕ КЛЕТОК КОСТНОГО МОЗГА ЭКСПЕРИМЕНТАЛЬНЫХ МЫШЕЙ НА ФОНЕ ИНЪЕКЦИИ ЦИКЛОФОСФАНА И ЭКЗОГЕННОЙ ДНК ЧЕЛОВЕКА Аннотация  PDF (Rus)  похожие документы
Е. В. Долгова, А. В. Прокопенко, В. П. Николин, Н. А. Попова, А. С. Проскурина, К. Е. Орищенко, Е. А. Алямкина, Я. Р. Ефремов, Е. Р. Черных, А. А. Останин, С. С. Богачев, Т. С. Гвоздева, Е. М. Малкова, О. С. Таранов, В. А. Рогачев, А. В. Панов, С. Н. Загребельный, М. А. Шурдов
"... использовался следу- ющий температурный режим: 94 °С – 2 мин – 1 цикл (94 °С – 30 с, 72 °С – 1,5 мин) – 35 цик ..."
 
Том 21, № 2 (2017) Разнообразие и распространение мобильных генетических элементов в геномах морских беспозвоночных Аннотация  PDF (Rus)  похожие документы
М. В. Пузаков, Л. В. Пузакова, И. К. Захаров
"... имеют полно­ ценные гены, кодирующие белки вирусного капсида; их относят к семейству ретровирусов ..."
 
Том 20, № 3 (2016) Отбор перспективных генотипов яблони на колонновидность и устойчивость к парше с помощью диагностических ДНК-маркеров Аннотация  PDF (Rus)  похожие документы
Н. И. Савельев, А. С. Лыжин, Н. Н. Савельева
"... мин, 35 циклов: 95 ºC – 30 с, 59 ºC – 1 мин, 72 ºC – 30 с; 72 ºC – 10 мин. Для идентификации в ..."
 
Том 21, № 4 (2017) Проблема сохранения генофондов доместицированных животных Аннотация  PDF (Rus)  похожие документы
Ю. А. Столповский, И. А. Захаров-Гезехус
"... , два вида – пшеница и рис, среди животных – шесть основных видов: крупный рогатый скот, куры, свиньи ..."
 
Том 19, № 4 (2015) Mетаболиты мозга у крыс линий НИСАГ и Вистар Аннотация  PDF (Rus)  похожие документы
О. Б. Шевелев, А. А. Серяпина, А. Л. Маркель, М. П. Мошкин
"... головного мозга и гипоталамуса крыс. За 5 мин до иссле- дования крыс обездвиживали газовым наркозом ..."
 
Том 16, № 1 (2012) ИДЕНТИФИКАЦИЯ ГЕНОВ УСТОЙЧИВОСТИ К ЛИСТОВОЙ РЖАВЧИНЕ В ВИДАХ AEGILOPS L., СИНТЕТИЧЕСКИХ ФОРМАХ И ИНТРОГРЕССИВНЫХ ЛИНИЯХ МЯГКОЙ ПШЕНИЦЫ Аннотация  PDF (Rus)  похожие документы
Э. Р. Давоян, Р. О. Давоян, И. В. Бебякина, О. Р. Давоян, Ю. С. Зубанова, А. Н. Зинченко, А. М. Кравченко
"... идентификации генов Lr Ген Условия амплификации фрагментов Размер фрагмента п.н. Lr9 94 °C 6 мин; 30 циклов (92 ..."
 
Том 17, № 4/1 (2013) БИОТЕХНОЛОГИЧЕСКИЙ ПОТЕНЦИАЛ НОВОЙ ТЕХНИЧЕСКОЙ КУЛЬТУРЫ – МИСКАНТУС СОРТ СОРАНОВСКИЙ Аннотация  PDF (Rus)  похожие документы
Н. М. Слынько, Т. Н. Горячковская, С. В. Шеховцов, С. В. Банникова, Н. В. Бурмакина, К. В. Старостин, А. С. Розанов, Н. Н. Нечипоренко, С. Г. Вепрев, В. К. Шумный, Н. А. Колчанов, С. Е. Пельтек
"... перемешивании. Затем к по- лученной смеси добавляли 1 мл хлороформа и центрифугировали 10 мин при 13000 об/мин ..."
 
Том 18, № 4/1 (2014) ИЗУЧЕНИЕ АЛЛЕЛЬНОГО СОСТАВА ГЕНОВ VRN-1 И PPD-1 У РАННЕСПЕЛЫХ И СРЕДНЕРАННИХ СОРТОВ ЯРОВОЙ МЯГКОЙ ПШЕНИЦЫ СИБИРИ Аннотация  PDF (Rus)  похожие документы
И. Е. Лихенко, А. И. Стасюк, А. Б. Щербань, А. Ф. Зырянова, Н. И. Лихенко, Е. А. Салина
"... FastPrep-24 (MP Biomedicals, USA) и инкуби- ровали на водяной бане при 60 °С в течение 30 мин. Затем ..."
 
Том 16, № 4/2 (2012) МЕЖПОРОДНАЯ И ВНУТРИПОРОДНАЯ РАЗНОТИПИЧНОСТЬ КРОЛИКОВ И ЕЕ РОЛЬ В СЕЛЕКЦИИ Аннотация  PDF (Rus)  похожие документы
Н. А. Балакирев, Р. М. Нигматуллин
"... , 1937. 368 с. Кулешов П.Н. Выбор по экстерьеру лошадей, скота, овец и свиней. М.: Сельхозиздат, 1937 ..."
 
Том 17, № 4/2 (2013) ЭВОЛЮЦИЯ ПУТЕМ ЕСТЕСТВЕННОГО ОТБОРА И ЕЕ АЛЬТЕРНАТИВЫ Аннотация  PDF (Rus)  похожие документы
П. М. Бородин
"... отряда. Если в эволюционной линии свиней и пекарей скорость фиксации была 1,76 пере- строек за 1 млн лет ..."
 
Том 21, № 4 (2017) К 100-летию выдающегося генетика-эволюциониста академика Дмитрия Константиновича Беляева Аннотация  PDF (Rus)  похожие документы
В. К. Шумный
"... (овец, свиней и пушных зверей) – для академического института это хороший показатель. Благодаря этим ..."
 
Том 21, № 3 (2017) Эффективность ольфакторного транспорта наночастиц оксида марганца (II) при однократном или многократном интраназальном введении Аннотация  PDF (Rus)  похожие документы
А. В. Ромащенко, М. Б. Шарапова, Д. В. Петровский, М. П. Мошкин
"... . Далее полученные частицы отмывали, для чего их осаждали центрифугированием при 12 000 об./мин в те ..."
 
Том 19, № 4 (2015) In vivo МРТ-визуализация динамики развития глиобластомы U87 в модели ортотопической ксенотрансплантации мышам линии SCID Аннотация  PDF (Rus)  похожие документы
Е. Л. Завьялов, И. А. Разумов, Л. А. Герлинская, А. В. Ромащенко
"... снимали с подложки раствором трипсин/версен и после � мин центрифугирования при 1��� об/мин осадок т�а ..."
 
Том 20, № 6 (2016) Динамика экспрессии транскрипционных факторов REL, RELA и IRF1 в макрофагоподобной линии U937 после воздействия диоксина Аннотация  PDF (Rus)  похожие документы
Е. В. Кашина, Д. Ю. Ощепков, Е. В. Антонцева, М. Ю. Шаманина, Д. П. Фурман, В. А. Мордвинов
"... , 0.5 мM ПМСФ, коктейль ингибиторов протеаз Pierce) в течение 15 мин на льду, затем добавляли 62 мкл ..."
 
Том 20, № 6 (2016) Морфофизиологические эффекты инсерционного мутагенеза гена контактин 5 (Cntn5) у трансгенных мышей Аннотация  PDF (Rus)  похожие документы
А. В. Смирнов, Н. А. Феофанова, Г. В. Концевая, М. В. Анисимова, И. И. Ковригин, И. А. Серова, М. П. Мошкин, Л. А. Герлинская, Н. Р. Баттулин
"... течение 12–16 ч с последующей инактивацией протеиназы (95 °С, 10 мин). Реакционная смесь для ПЦР объемом ..."
 
Том 21, № 2 (2017) Полиморфизм RAPD- и ISSR-маркеров у зерновых видов амаранта Аннотация  PDF (Rus)  похожие документы
С. В. Лиманская, Л. А. Мирошниченко, Т. И. Гопций, О. С. Корнеева
"... ) RAPD­анализ: 1 цикл – денатурация при 94 °С – 5 мин; 45 циклов: 94 °С – 1 мин, отжиг – 36 °С – 1 мин ..."
 
Том 16, № 1 (2012) ОЦЕНКА ГЕНЕТИЧЕСКОГО ПОЛИМОРФИЗМА ОБРАЗЦОВ ЯРОВОЙ ТРИТИКАЛЕ (× TRITICOSECALE WITTMACK) ПОСРЕДСТВОМ RAPD- И ISSR-МАРКЕРОВ Аннотация  PDF (Rus)  похожие документы
О. А. Орловская, Л. В. Корень, Л. В. Хотылева
"... в амплификаторе Bio-Rad в следующих услови- ях: 94 °С 3 мин; 40/44 (ISSR/RAPD) циклов – Таблица 1 ..."
 
Том 17, № 4/1 (2013) ВЫДЕЛЕНИЕ И ИССЛЕДОВАНИЕ СВОЙСТВ БАКТЕРИЙ ТЕРМАЛЬНЫХ ИСТОЧНИКОВ СЕВЕРНОГО ПРИБАЙКАЛЬЯ, ОБЛАДАЮЩИХ ЛИПОЛИТИЧЕСКОЙ АКТИВНОСТЬЮ Аннотация  PDF (Rus)  похожие документы
К. Н. Сорокина, А. С. Розанов, А. В. Брянская, С. Е. Пельтек
"... - полимеразы («Сибэнзим», Россия). ПЦР проводили по следующей программе: 95 °С – 3 мин; 40 циклов (95 °С – 30 ..."
 
Том 19, № 3 (2015) Эффективный метод идентификации штаммов Escherichia coli, выделенных из различных органов домашней птицы (Gallus gallus domesticus) Аннотация  PDF (Rus)  похожие документы
В. П. Терлецкий, В. И. Тыщенко, О. Б. Новикова, Э. Д. Джавадов, И. Я. Шахтамиров, Н. Л. Адаев
"... нейлоно- вый фильтр. Процесс длился 30–60 мин и проводился в дистиллированной воде на приборе вакуумного ..."
 
Том 19, № 4 (2015) Стресс и артериальная гипертония: крысы линии НИСАГ (ISIAH) Аннотация  PDF (Rus)  похожие документы
Е. В. Антонов, Ю. В. Александрович, А. А. Серяпина, Л. О. Климов, А. Л. Маркель
"... , наркотизи- рованных эфиром (рауш-наркоз). Такой кратковременный (5–6 мин) наркоз позволял провести ..."
 
Том 19, № 4 (2015) Магнитно-резонансная спектроскопия нейрометаболитов в гиппокампе у агрессивных и ручных самцов крыс Аннотация  PDF (Rus)  похожие документы
Р. Г. Гулевич, А. Е. Акулов, С. Г. Шихевич, Р. В. Кожемякина, И. З. Плюснина
"... 15 мин до проведения процедуры крыс наркотизировали внутрибрюшинным введением 10 % тиопентала (0 ..."
 
Том 20, № 2 (2016) 5-HT1А рецептор: роль в регуляции различных видов поведения Аннотация  PDF (Rus)  похожие документы
В. С. Науменко, Е. Г. Понимаскин, Н. К. Попова
"... , были показаны на мышах и свиньях. Отмечено значитель- ное повышение экспрессии гена и плотности ..."
 
Том 18, № 2 (2014) ДИНАМИКА ЭКСПРЕССИИ ЦИТОКИНА IL-12 В МАКРОФАГАХ ЧЕЛОВЕКА ПОСЛЕ ИХ ОБРАБОТКИ ДИОКСИНОМ Аннотация  PDF (Rus)  похожие документы
Д. Ю. Ощепков, Е. В. Кашина, Е. В. Антонцева, Е. А. Ощепкова, В. А. Мордвинов, Д. П. Фурман
"... обрабатывались 10нМ 2,3,7,8- ТХДД (опыт) или 0,1 % (v/v) диметилсульфок- сидом (контроль) в течение 15 мин; 1 ч ..."
 
Том 17, № 4/1 (2013) ЭКСПРЕССИЯ ГЕНОВ И ВТОРИЧНЫЕ СТРУКТУРЫ В мРНК В РАЗНЫХ ВИДАХ Mycoplasma Аннотация  PDF (Rus)  похожие документы
В. С. Соколов, В. А. Лихошвай, Ю. Г. Матушкин
"... Собаки C.M. haematoparvum M. haemocanis Овцы и козы M. ovis Свиньи M. suis Коровы M. wenyonii Ламы и ..."
 
Том 19, № 1 (2015) Индукцию тирозинаминотрансферазы у мышей ингибируют активированные метаболиты орто-аминоазотолуола Аннотация  PDF (Rus)  похожие документы
В. И. Каледин, С. И. Ильницкая, Н. А. Попова, О. А. Коваль, И. А. Пышная, Л. Ф. Гуляева
"... оливковом масле – однократно в/б в дозе 11–14 мг/кг за 45 мин до введения ОАТ. Влияние CoC�2 на содержание ..."
 
Том 18, № 4/1 (2014) ВАРИАБЕЛЬНОСТЬ ФРАГМЕНТА ГЕНА КИСЛОЙ ВАКУОЛЯРНОЙ ИНВЕРТАЗЫ PAIN-1 У СОРТОВ КАРТОФЕЛЯ Аннотация  PDF (Rus)  похожие документы
М. А. Слугина, Е. З. Кочиева
"... профиль ПЦР был следующим: 1) первый цикл: 94 °С – 5 мин; 2) последующие 35 циклов: 94 °С – 30 с, 57 ..."
 
1 - 100 из 228 результатов 1 2 3 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)