Поиск


Сортировать по:     
 
Выпуск Название
 
Том 18, № 4/1 (2014) ВАРИАБЕЛЬНОСТЬ ФРАГМЕНТА ГЕНА КИСЛОЙ ВАКУОЛЯРНОЙ ИНВЕРТАЗЫ PAIN-1 У СОРТОВ КАРТОФЕЛЯ Аннотация  PDF (Rus)  похожие документы
М. А. Слугина, Е. З. Кочиева
"... detected. A new SNP, С1895, was found in exon VII. Five of eight SNPs located in exons led to amino acid ..."
 
Том 21, № 3 (2017) Анализ полиморфизма экзона-4 гена VERNALIZATION-A1 у видов полиплоидной пшеницы Аннотация  PDF (Rus)  похожие документы
А. Ф. Мутерко, Е. А. Салина
"... 1 genes. In recent studies, an association of missense mutations within VERNALIZATION-A1 exon-4 ..."
 
Том 22, № 1 (2018) ВНУТРИВИДОВОЙ ПОЛИМОРФИЗМ ГЕНА САХАРОЗОСИНТАЗЫ Sus1 У ОБРАЗЦОВ Pisum sativum L. Аннотация  PDF (Rus)  похожие документы
Е. А. Дьяченко, М. А. Слугина
"... . In coding sequences, 47 SNPs were found, wherein the most variable was the exon II. 16 exon SNPs led ..."
 
Том 21, № 3 (2017) Полиморфизм гена холодового рецептора TRPM8 у коренного населения Сибири: возможное адаптивное значение полиморфизма rs11563208 на северо-востоке Азии Аннотация  PDF (Rus)  похожие документы
Б. А. Малярчук, М. В. Деренко
"... sensitivity. In the present study we have investigated variability of all exons and adjacent intronic ..."
 
Том 19, № 6 (2015) Фланкирующие повторы мономеров определяют пониженную контекстную сложность сайтов однонуклеотидных полиморфизмов в геноме человека Аннотация  PDF (Rus)  похожие документы
Н. С. Сафронова, М. П. Пономаренко, И. И. Абнизова, Г. В. Орлова, И. В. Чадаева, Ю. Л. Орлов
"...  nucleotide polymorphisms (SNPs) from the “1000 genomes” project. We have developed and applied novel ..."
 
Том 19, № 5 (2015) Полиморфизм гена TRPM8 в кыргызской популяции: возможная связь с высокогорной адаптацией Аннотация  PDF (Rus)  похожие документы
В. Н. Бабенко, Ж. Т. Исакова, Э. Т. Талайбекова, Д. А. Асамбаева, В. Ф. Кобзев, Т. А. Потапова, М. И. Воевода, А. А. Алдашев
"... , and three of them are confined to a segment of 20 bp in exon 7. The frequencies of minor SNP alleles are: rs ..."
 
Том 18, № 4/2 (2014) АНАЛИЗ ВЗАИМОДЕЙСТВИЯ АЛЛЕЛЕЙ ГЕНОВ ЛИПИДНОГО ОБМЕНА ПРИ ДИСЛИПИДЕМИИ Аннотация  PDF (Rus)  похожие документы
И. В. Николаев, Р. В. Мулюкова, Л. Р. Каюмова, Е. В. Воробьева, В. Ю. Горбунова
"... . Associations of certain SNPs (G-2548A in the promoter region of the leptin gene (LEP), A223G in exon 4 ..."
 
Том 17, № 4/1 (2013) ПРОГРАММНЫЙ КОМПЛЕКС SNP-MED ДЛЯ АНАЛИЗА ВЛИЯНИЯ ОДНОНУКЛЕОТИДНЫХ ПОЛИМОРФИЗМОВ НА ФУНКЦИЮ ГЕНОВ, СВЯЗАННЫХ С РАЗВИТИЕМ СОЦИАЛЬНО ЗНАЧИМЫХ ЗАБОЛЕВАНИЙ Аннотация  PDF (Rus)  похожие документы
Н. Л. Подколодный, Д. А. Афонников, Ю. Ю. Васькин, Л. О. Брызгалов, В. А. Иванисенко, П. С. Деменков, М. П. Пономаренко, Д. А. Рассказов, К. В. Гунбин, И. В. Процук, И. Ю. Шутов, П. Н. Леонтьев, М. Ю. Фурсов, Н. П. Бондарь, Е. В. Антонцева, Т. И. Меркулова, Н. А. Колчанов
"... This paper describes the SNP-MED modular computer-based information system for estimation ..."
 
Том 18, № 4/2 (2014) ПОЛНОГЕНОМНЫЙ АНАЛИЗ ПУЛИРОВАННЫХ ВЫБОРОК ДНК КОГОРТ ЧЕЛОВЕКА Аннотация  PDF (Rus)  похожие документы
В. Н. Бабенко, В. Н. Максимов, Е. В. Кулакова, Н. С. Сафронова, М. И. Воевода, Е. И. Рогаев
"... (SNPs) obtained in genome-wide pooled allelotyping of 16 human cohorts, comprising healthy and ill ..."
 
Том 20, № 6 (2016) Выявление новых регуляторных SNP, ассоциированных с предрасположенностью к развитию колоректального рака Аннотация  PDF (Rus)  похожие документы
Е. Ю. Леберфарб, Л. О. Брызгалов, И. И. Брусенцов, Т. И. Меркулова
"... A new approach to the search for regulatory SNPs (rSNPs) based on the use of ENCODE project data ..."
 
Том 20, № 6 (2016) Кандидатные SNP-маркеры социального доминирования, способные влиять на сродство ТАТА-связывающего белка к промоторам генов человека Аннотация  PDF (Rus)  похожие документы
И. В. Чадаева, Д. А. Рассказов, Е. Б. Шарыпова, Л. К. Савинкова, П. М. Пономаренко, М. П. Пономаренко
"... and if a polymorphism (SNP) can cause superexpression of the human gene homologous of the animal gene encoding ..."
 
Том 19, № 6 (2015) Прогноз и верификация влияния SN P rs367781716 на взаимодействие ТАТА -связывающего белка с промотором гена АВСА9 человека Аннотация  PDF (Rus)  похожие документы
О. В. Аркова, И. А. Драчкова, Т. В. Аршинова, Д. А. Рассказов, В. В. Суслов, П. М. Пономаренко, М. П. Пономаренко, Н. А. Колчанов, Л. К. Савинкова
"...  genetic loci and single nucleotide polymorphisms (SNPs) in medicine. Analysis of SNP markers ..."
 
Том 17, № 4/1 (2013) ОЦЕНКА ПО ТЕХНОЛОГИИ rSNP_Guide SNPs ПРОМОТОРОВ ГЕНОВ АРС И МLH1 ЧЕЛОВЕКА, СВЯЗАННЫХ С РАКОМ ТОЛСТОГО КИШЕЧНИКА Аннотация  PDF (Rus)  похожие документы
Д. А. Рассказов, Е. В. Антонцева, Л. О. Брызгалов, М. Ю. Матвеева, Е. В. Кашина, П. М. Пономаренко, Г. В. Орлова, М. П. Пономаренко, Д. А. Афонников, Т. И. Меркулова
"... Six regulatory SNPs (single nucleotide polymorphisms) of two human APC and MLH1 genes (rs75996864 ..."
 
Том 19, № 6 (2015) Биомедицинские и кандидатные SN P-маркеры для хронопатологий могут достоверно изменять сродство ТАТА -связывающего белка к промоторам генов человека Аннотация  PDF (Rus)  похожие документы
Д. А. Рассказов, Н. Л. Подколодный, О. Л. Подколодная, Н. Н. Подколодная, В. В. Суслов, Л. К. Савинкова, П. М. Пономаренко, М. П. Пономаренко
"... Computational analysis of millions of unannotated SNPs from the 1000 Genomes Project may speed up ..."
 
Том 19, № 5 (2015) Селекция гибридных форм как стимул развития молекулярно-генетических исследований у ржи Аннотация  PDF (Rus)  похожие документы
Р. Шлегель
"... ; gene ma��ing; lin�age studies; �hysical ma��ing; QTl; SnP; rFlP. e-mail�� rolf.schlegel@t-online ..."
 
Том 20, № 1 (2016) Ассоциация несинонимичной замены в гене конденсина NCAPG с признаками яйца кур-несушек Аннотация  PDF (Rus)  похожие документы
О. Ю. Баркова, М. Г. Смарагдов
"... traits of domestic chicken has been studied. Associations of the SNP alleles of the rs14491030 marker ..."
 
Том 19, № 6 (2015) Оценка роли однонуклеотидного полиморфизма в гене лимфотоксина бета при доместикации свиньи на основе биоинформационного и экспериментального подходов Аннотация  PDF (Rus)  похожие документы
Р. Б. Айтназаров, Е. В. Игнатьева, Н. Э. Базарова, В. Г. Левицкий, С. П. Князев, Я. Гон, Н. С. Юдин
"... ) determination of frequencies of genotypes and alleles of the rs340283541 SNP in the gene for the lymphotoxin ..."
 
Том 20, № 2 (2016) Влияние раннего провоспалительного стресса на экспрессию различных транскриптов BDNF в отделах мозга самцов крыс препубертатного возраста Аннотация  PDF (Rus)  похожие документы
Д. И. Перегуд, С. В. Фрейман, А. О. Тишкина, Л. С. Сохраняева, Н. А. Лазарева, М. В. Онуфриев, М. Ю. Степаничев, Н. В. Гуляева
"...  in neuroplastic changes in health as well as at pathology. The BDNF gene is transcribed to exon-specific mRNAs ..."
 
Том 18, № 3 (2014) ОСОБЕННОСТИ ЦЕЛЛЮЛОЗ ИЗ РАЗЛИЧНЫХ МОРФОЛОГИЧЕСКИХ ЧАСТЕЙ МИСКАНТУСА СОРТА СОРАНОВСКИЙ Аннотация  PDF (Rus)  похожие документы
Ю. А. Гисматулина, В. В. Будаева, С. Г. Вепрев, Г. В. Сакович, В. К. Шумный
"... samples were for the first time obtained from leaves and stems separately by two methods (nitric-acid ..."
 
Том 20, № 1 (2016) Скорость роста и продуктивность бройлерного кросса кур с разными полиморфными типами гена миостатина Аннотация  PDF (Rus)  похожие документы
Н. В. Дементьева, О. В. Митрофанова, В. И. Тыщенко, В. П. Терлецкий, А. Ф. Яковлев
"... The search for single nucleotide polymorphisms (SNP) in the myostatin gene is a promising ..."
 
Том 19, № 6 (2015) Влияние однонуклеотидных полиморфных замен в районах позиционирования РНК -полимеразы II на сродство к ним TBP в генах циркадных часов человека Аннотация  PDF (Rus)  похожие документы
О. А. Подколодная, Д. А. Рассказов, Н. Л. Подколодный, Н. Н. Подколодная, В. В. Суслов, Л. К. Савинкова, П. М. Пономаренко, М. П. Пономаренко
"...  systems, leading to the development of a pathologies. We analyzed the influence of SNPs localized ..."
 
Том 18, № 4/2 (2014) ВОССТАНОВЛЕНИЕ АМИНОКИСЛОТНОЙ ПОСЛЕДОВАТЕЛЬНОСТИ ЦИКЛИЧЕСКИХ ПЕПТИДОВ ИЗ МАСС-СПЕКТРОВ Аннотация  PDF (Rus)  похожие документы
Э. С. Фомин
"... sequences of lengths up to 160 amino acid residues. ..."
 
Том 17, № 4/1 (2013) МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ СИНТЕЗА БИОЭТАНОЛА И МОЛОЧНОЙ КИСЛОТЫ ТЕРМОФИЛЬНЫМИ БАКТЕРИЯМИ РОДА Geobacillus Аннотация  PDF (Rus)  похожие документы
М. А. Нуриддинов, Ф. В. Казанцев, А. С. Розанов, К. Н. Козлов, С. Е. Пельтек, Н. А. Колчанов, И. Р. Акбердин
"... A mathematical model of the ethanol and lactic acid biosynthesis in the cells of Geobacillus spp ..."
 
Том 17, № 4/1 (2013) SNP_TATA_COMPARATOR: Web -СЕРВИС ПРИМЕНЕНИЯ УРАВНЕНИЯ РАВНОВЕСИЯ ТВР/ТАТА-КОМПЛЕКСА В СРАВНИТЕЛЬНОЙ ОЦЕНКЕ SNPs ПРОМОТОРОВ ГЕНОВ, СВЯЗАННЫХ С БОЛЕЗНЯМИ ЧЕЛОВЕКА Аннотация  PDF (Rus)  похожие документы
Д. А. Рассказов, К. В. Гунбин, П. М. Пономаренко, О. В. Вишневский, М. П. Пономаренко, Д. А. Афонников
"... Web-service SNP_TATA_Comparator has been developed for using experimentally proven in silico ..."
 
Том 22, № 6 (2018) Генетическая изменчивость бурятской и алтайской пород крупного рогатого скота, оцененная на основе анализа полиморфизма генов GH1, GHR и PRL Аннотация  похожие документы
И. В. Лазебная, А. В. Перчун, Б. Б. Лхасаранов, О. Е. Лазебный, Ю. А. Столповский
"... _000176.1: BTA 19, exon 5, rs41923484, g.2141C>G, L127V), GHR (AC_000177.1: BTA 20, exon 10, rs109300983 ..."
 
Том 22, № 7 (2018) Поиск изменений нуклеотидной последовательности гена ремоделирования хроматина PBRM1 у пациентов со светлоклеточным раком почки Аннотация  PDF (Rus)  похожие документы
Е. А. Климентова, И. Р. Гилязова, А. А. Измайлов, И. М. Султанов, М. А. Бермишева, В. Н. Павлов, Э. К. Хуснутдинова
"... sequencing. In the PBRM1 gene, two somatic mutations were found (c.233G>A (p.D45N) in exon 2, c.1675-1676 ..."
 
Том 17, № 4/1 (2013) КОМПЬЮТЕРНЫЙ АНАЛИЗ ДАННЫХ ЭКСПРЕССИИ ГЕНОВ В КЛЕТКАХ МОЗГА, ПОЛУЧЕННЫХ С ПОМОЩЬЮ МИКРОЧИПОВ И ВЫСОКОПРОИЗВОДИТЕЛЬНОГО СЕКВЕНИРОВАНИЯ Аннотация  PDF (Rus)  похожие документы
И. В. Медведева, О. В. Вишневский, Н. С. Сафронова, О. С. Кожевникова, М. А. Генаев, Д. А. Афонников, А. В. Кочетов, Ю. Л. Орлов
"... of exons and active transcripts in genes differentially expressed in different organs are considered ..."
 
Том 22, № 6 (2018) Оценка современного состояния генофонда холмогорской и чернопестрой пород крупного рогатого скота на основе полногеномного SNP-анализа Аннотация  похожие документы
А. В. Доцев, А. А. Сермягин, А. В. Шахин, И. А. Паронян, К. В. Племяшов, Х. Рейер, К. Виммерс, Г. Брем, Н. А. Зиновьева
"... . The aforementioned breeds were studied using their whole-genome single nucleotide polymorphism (SNP) genotypes ..."
 
Том 22, № 5 (2018) Полногеномный анализ ассоциаций с устойчивостью к грибным болезням в коллекции сои в условиях Юго-Восточного и Южного Казахстана Аннотация  похожие документы
А. Затыбеков, С. Абугалиева, С. Дидоренко, А. Рсалиев, Е. Туруспеков
"... spot (BS). GWAS using 4 442 SNP (single nucleotide polymorphism) markers of Illumina iSelect array ..."
 
Том 22, № 5 (2018) Оценка вклада монгольской экспансии в генофонд тувинцев Аннотация  похожие документы
Л. Д. Дамба, Е. В. Балановская, M. К. Жабагин, Ю. М. Юсупов, Ю. В. Богунов, Ж. М. Сабитов, А. Т. Агджоян, Н. А. Короткова, М. Б. Лавряшина, Б. Б. Монгуш, У. Н. Кавай-оол, О. П. Балановский
"... in a whole. According to the data of 59 Y-chromosomal SNP markers, the haplogroup spectra in these Tuvinian ..."
 
Том 17, № 4/1 (2013) СОВРЕМЕННОЕ СОСТОЯНИЕ ИССЛЕДОВАНИЙ В ОБЛАСТИ ГЕНЕТИЧЕСКОЙ И МЕТАБОЛИЧЕСКОЙ ИНЖЕНЕРИИ БАКТЕРИЙ РОДА Geobacillus, НАПРАВЛЕННЫХ НА ПОЛУЧЕНИЕ ЭТАНОЛА И ОРГАНИЧЕСКИХ КИСЛОТ Аннотация  PDF (Rus)  похожие документы
А. С. Розанов, И. А. Мещерякова, С. В. Шеховцов, С. Е. Пельтек
"... . 163. P. 13–20. Afzal M., Oommen S., Al-Awadi S. Transformation of chenodeoxycholic acid by ..."
 
Том 22, № 7 (2018) Варьирование жирнокислотного состава масла семян в коллекции индуцированных мутантов льна масличного (Linum humile Mill.) Аннотация  PDF (Rus)  похожие документы
А. В. Тигова, А. И. Сорока
"... by morphometric characteristics. The fatty acid composition of seed oil for the isolated mutant specimens ..."
 
Том 22, № 2 (2018) Мутация yellow в локусе agouti устраняет возрастное повышение экспрессии генов белков, регулирующих окисление жирных кислот в мышцах у мышей Аннотация  PDF (Rus)  похожие документы
Ю. В. Пискунова, А. Ю. Казанцева, А. В. Бакланов, Н. М. Бажан
"... transferase 1b (Cpt1b) (free fatty acids oxidation), solute carrier family 2 (facilitated glucose transporter ..."
 
Том 22, № 3 (2018) СЕЛЕКЦИЯ НА СОДЕРЖАНИЕ АНТИОКСИДАНТОВ В ЗЕРНЕ КАК ПЕРСПЕКТИВНОЕ НАПРАВЛЕНИЕ ДЛЯ ПОЛУЧЕНИЯ ПРОДУКТОВ ЗДОРОВОГО ПИТАНИЯ Аннотация  PDF (Rus)  похожие документы
В. И. Полонский, И. Г. Лоскутов, А. В. Сумина
"... nutritional value, contain unsaturated fatty acids, basic minerals, proteins and β-glucans (the highest levels ..."
 
Том 20, № 5 (2016) Результаты использования клеточных технологий в создании новых сортов ячменя, устойчивых к токсичности алюминия и засухе Аннотация  PDF (Rus)  похожие документы
О. Н. Шуплецова, И. Н. Щенникова
"... varieties and standard varieties in productivity, especially under provocative conditions of acid soils ..."
 
Том 22, № 3 (2018) ПЛАСТИЧНОСТЬ ОБРАЗА ЖИЗНИ У ГРУППЫ ОЗИМЫХ ОБРАЗЦОВ ПШЕНИЦЫ И ТРИТИКАЛЕ Аннотация  PDF (Rus)  похожие документы
В. Е. Козлов, В. И. Пономаренко, Е. П. Размахнин
"... “winter-spring” plants were generated in an extremely unfavourable environment: sandy acid soil (pH 4.9–5 ..."
 
Том 16, № 1 (2012) АНТИМИКРОБНЫЕ ПЕПТИДЫ ПШЕНИЦЫ Аннотация  PDF (Rus)  похожие документы
Т. И. Одинцова, Т. В. Коростылева, Л. Л. Уткина, Я. А. Андреев, А. А. Славохотова, Е. А. Истомина, В. А. Пухальский, Ц. А. Егоров
"... of families of plant AMPs have been isolated on the base of amino acid sequence similarity and 3D structure ..."
 
Том 21, № 7 (2017) Использование геномных данных в селекции птицы Аннотация  PDF (Rus)  похожие документы
А. Ф. Яковлев, Н. В. Дементьева
 
Том 21, № 5 (2017) Генетический полиморфизм и сопутствующие факторы риска ишемического инсульта в монгольской популяции Китая Аннотация  похожие документы
Ч. У, Х. У, Ю. Л. Орлов, Г. Гегентана, В. Хуо, А. О. Брагин, Н. У, С. Суялату, Ф. Жао, Ж. Жао, Л. Э. Табиханова, М. Чен, Х. Бай
"... was detected with single nucleotide polymorphisms (SNPs) located within genes NINJ2 (rs12425791) and ALDH2 (rs ..."
 
Том 20, № 6 (2016) Морфофизиологические эффекты инсерционного мутагенеза гена контактин 5 (Cntn5) у трансгенных мышей Аннотация  PDF (Rus)  похожие документы
А. В. Смирнов, Н. А. Феофанова, Г. В. Концевая, М. В. Анисимова, И. И. Ковригин, И. А. Серова, М. П. Мошкин, Л. А. Герлинская, Н. Р. Баттулин
"... of splice variants of Cntn5 exons that flank the transgene integration site. These data suggest ..."
 
Том 18, № 3 (2014) ГЕНОФОНД ЯБЛОНИ И СЕЛЕКЦИЯ НА УЛУЧШЕНИЕ БИОХИМИЧЕСКОГО СОСТАВА ПЛОДОВ Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов, М. А. Макаркина, З. М. Серова
"... dry matter, total sugar, titratable acids, pectin, ascorbic acid, and P-active substances have been ..."
 
Том 20, № 5 (2016) Метаболомный подход к сравнительному анализу диких и культурных видов овса (Avena L.) Аннотация  PDF (Rus)  похожие документы
И. Г. Лоскутов, Т. В. Шеленга, А. В. Конарев, А. Л. Шаварда, Е. В. Блинова, Н. И. Дзюбенко
"... ). The analysis covered the composition and content of organic and fatty acids, amino acids, polyatomic spirits ..."
 
Том 18, № 4/1 (2014) КАРТИРОВАНИЕ ЛОКУСОВ, КОНТРОЛИРУЮЩИХ УСТОЙЧИВОСТЬ ЯЧМЕНЯ К РАЗЛИЧНЫМ ИЗОЛЯТАМ PYRENOPHORA TERES F. TERES И COCHLIOBOLUS SATIVUS Аннотация  PDF (Rus)  похожие документы
О. С. Афанасенко, А. В. Козьяков, П. Хедлэй, Н. М. Лашина, А. В. Анисимова, О. Маннинен, М. Ялли, Е. К. Потокина
"... _11067 SNP marker was revealed on chromosome 6H position 58 cM in double haploid (DH) population A developed ..."
 
Том 20, № 6 (2016) Вычислительные проблемы анализа ошибок коротких прочтений ДНК при секвенировании следующего поколения Аннотация  похожие документы
Р. те Боекхорст, Ф. М. Науменко, Н. Г. Орлова, Э. Р. Галиева, А. М. Спицина, И. В. Чадаева, Ю. Л. Орлов, И. И. Абнизова
"... linguistically complex sequences of introns are less covered with reads than more complex sequences of exons ..."
 
Том 18, № 3 (2014) СОЗДАНИЕ ПАНЕЛИ ДНК ПОРОД КРУПНОГО РОГАТОГО СКОТА РОССИИ ДЛЯ ГЕНОМНЫХ ИССЛЕДОВАНИЙ Аннотация  PDF (Rus)  похожие документы
Н. С. Юдин, Л. А. Васильева, В. А. Белявская, Р. Б. Айтназаров, П. Н. Смирнов, М. Хитон, У. Легрейд, Г. В. Орлова, А. Г. Ромащенко, М. И. Воевода
"... .1 in the power of SNP identification (number of unshared haploid genomes = 186,1, minimum allele frequency ..."
 
Том 19, № 5 (2015) Противоположные ассоциации мутаций генов HRAS и KRAS с клиническими параметрами рака мочевого пузыря Аннотация  PDF (Rus)  похожие документы
М. П. Смаль, А. И. Ролевич, Т. И. Набебина, С. А. Красный, Р. И. Гончарова
"... для каждого SNP внутренних праймеров, описанных в работе Kompier с коллегами (2010), и набо­ ра ..."
 
Том 16, № 4/1 (2012) ICGenonics: ПРОГРАММНЫЙ КОМПЛЕКС АНАЛИЗА СИМВОЛЬНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ГЕНОМИКИ Аннотация  PDF (Rus)  похожие документы
Ю. Л. Орлов, А. О. Брагин, И. В. Медведева, К. В. Гунбин, П. С. Деменков, О. В. Вишневский, В. Г. Левицкий, Д. Ю. Ощепков, Н. Л. Подколодный, Д. А. Афонников, И. Гроссе, Н. А. Колчанов
"... in nucleotide and amino acid sequences; prediction of nucleosome positioning; and structural and functional ..."
 
Том 20, № 4 (2016) Системно-биологический анализ гена WOX5 и его функций в нише стволовых клеток корня Аннотация  PDF (Rus)  похожие документы
Е. А. Ощепкова, Н. А. Омельянчук, М. С. Савина, Т. Пастернак, Н. А. Колчанов, Е. В. Землянская
"... analysis on 62 publicly available WOX5 amino acid sequences, generalized published data about WOX5 ..."
 
Том 19, № 2 (2015) CAPS-маркеры в биологии растений Аннотация  PDF (Rus)  похожие документы
Ю. Н. Шавруков
"... Polymorphism, SNP), а также инсерции или делеции (Insertion-Deletion, InDel) (Хлесткина, Салина, 2006; Jehan ..."
 
Том 18, № 2 (2014) РОЛЬ ПОЛИМОРФИЗМА ГЕНА PANE1 В ФОРМИРОВАНИИ РЕПРОДУКТИВНЫХ ПОКАЗАТЕЛЕЙ У СВИНЕЙ Аннотация  PDF (Rus)  похожие документы
Н. С. Юдин, Р. Б. Айтназаров, С. П. Князев, В. А. Бекенев, Ю. В. Подоба, А. Б. Бердибаева, М. И. Воевода
"... ). In the present study, the frequency of the SNP was determined in domestic pigs and wild boars, and its ..."
 
Том 17, № 1 (2013) ОСНОВНЫЕ ПРИЧИНЫ НИЗКОЙ ЭФФЕКТИВНОСТИ ПОЛУЧЕНИЯ АЛЮМОУСТОЙЧИВЫХ РЕГЕНЕРАНТОВ ЗЕРНОВЫХ КУЛЬТУР Аннотация  PDF (Rus)  похожие документы
Е. М. Лисицын
"... of genotypes into resistant and sensitive, accepted in practice; appearance of acid- and aluminum-resistant ..."
 
Том 19, № 1 (2015) Использование генофонда яблони: источники и доноры хозяйственно полезных признаков Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов
"... contents of sugars, titrated acids and biologically active substances (ascorbic acid and P-active ..."
 
Том 21, № 1 (2017) Достижения и перспективы использования методов высокопроизводительного секвенирования в генетике и селекции картофеля Аннотация  PDF (Rus)  похожие документы
И. В. Быкова, Н. А. Шмаков, Д. А. Афонников, А. В. Кочетов, Е. К. Хлесткина
"... , but also genome sequence-based investigations uncovering features of potato genome evolution, SNP ..."
 
Том 17, № 4/2 (2013) ПОПУЛЯЦИОННО-ГЕНЕТИЧЕСКИЕ ОСНОВЫ СОХРАНЕНИЯ ГЕНОФОНДОВ ДОМЕСТИЦИРОВАННЫХ ВИДОВ ЖИВОТНЫХ Аннотация  PDF (Rus)  похожие документы
Ю. А. Столповский
"... (или чипов) для анализа SNP. ФАО опублико- вала рекомендации по ряду микросателлитных локусов для их ..."
 
Том 19, № 3 (2015) Применение репродуктивных технологий для повышения эффективности геномной селекции молочного крупного рогатого скота Аннотация  PDF (Rus)  похожие документы
Н. С. Юдин, К. И. Лукьянов, М. И. Воевода, Н. А. Колчанов
"... in breeding programs; imputation of genotypes for absent SNPs with low marker density microarrays ..."
 
Том 19, № 3 (2015) Маркер-контролируемое выявление генотипов кукурузы с улучшенным качеством белка Аннотация  PDF (Rus)  похожие документы
О. А. Орловская, С. В. Кубрак, С. И. Вакула, Л. В. Хотылева, А. В. Кильчевский
"... improvement can increase its nutritive and energy value. Deficiency of two essential amino acids (lysine ..."
 
Том 17, № 1 (2013) ИСПОЛЬЗОВАНИЕ АЛЛЕЛЬ-СПЕЦИФИЧНЫХ МАРКЕРОВ ГЕНОВ PPD И VRN ДЛЯ ПРОГНОЗИРОВАНИЯ ПРОДОЛЖИТЕЛЬНОСТИ ВЕГЕТАЦИОННОГО ПЕРИОДА СОРТОВ ЯЧМЕНЯ Аннотация  PDF (Rus)  похожие документы
М. М. Злотина, О. Н. Ковалева, И. Г. Лоскутов, Е. К. Потокина
"... -exon2-F1: TCCCAAGAAAACTTGAACAACACCAG HvBM5Aexon2-R1: ATTAGGTTACATCATTCGACCA 60 616 или 574 Vrn-H ..."
 
Том 20, № 6 (2016) База данных генов, повышающих устойчивость пшеницы и родственных ей злаков к патогенным грибам Аннотация  PDF (Rus)  похожие документы
О. Г. Смирнова, А. В. Кочетов
"... third one is a C/T SNP in exon 12, where an amino acid is altered. No difference within 2 kb of the ..."
 
Том 21, № 7 (2017) Моделирование болезни Хантингтона на клетках линии HEK293 Аннотация  PDF (Rus)  похожие документы
Д. В. Шарипова, Т. Б. Маланханова, А. А. Малахова
"... expansion in the first exon of HTT gene. The mutant HTT protein has an elongated polyglutamine tract ..."
 
Том 19, № 3 (2015) Модулирующее действие мутаций генов, затрагивающих окраску волосяного покрова, на генерацию и нейтрализацию активных форм кислорода. Американская норка (Neovison vison) как модель Аннотация  PDF (Rus)  похожие документы
С. Н. Сергина, В. А. Илюха, И. В. Баишникова, Т. Н. Ильина
"... of antioxidant enzymes’ activities as well as of thiobarbituric acid-reactive products (TBА-RPs), characterizing ..."
 
Том 16, № 4/2 (2012) ИСПОЛЬЗОВАНИЕ МОДИФИЦИРОВАННЫХ МЕТОДИК ОЦЕНКИ КАЧЕСТВА ЗЕРНА ПШЕНИЦЫ НА ФОНЕ ПОРАЖЕНИЯ КЛОПОМ-ЧЕРЕПАШКОЙ Аннотация  PDF (Rus)  похожие документы
Е. Н. Шаболкина, О. М. Сычёва, В. В. Сюков
"... of organic acids in gluten quality assay with an IDK device and farinographic measurement of dough ..."
 
Том 16, № 2 (2012) ИССЛЕДОВАНИЕ ТЕРМОСТАБИЛЬНОСТИ МУТАНТНЫХ ФОРМ БЕЛКА БАРНАЗЫ С ИСПОЛЬЗОВАНИЕМ ПРОГРАММНОГО КОМПЛЕКСА MOLKERN Аннотация  PDF (Rus)  похожие документы
Э. С. Фомин, Н. А. Алемасов
"... . The method has been implemented in the MOLKERN software package. Mutations of amino acids with non-zero ..."
 
Том 22, № 2 (2018) Выявление генов, вовлеченных в контроль белой окраски головы, у восьми российских пород крупного рогатого скота Аннотация  PDF (Rus)  похожие документы
Н. С. Юдин, Н. М. Белоногова, Д. М. Ларкин
"... breeds. The data on genome-wide genotyping of 131,709 high-quality single nucleotide polymorphisms (SNPs ..."
 
Том 22, № 4 (2018) АССОЦИАЦИЯ ПОЛИМОРФИЗМА ГЕНОВ 2′-5′-ОЛИГОАДЕНИЛАТСИНТЕТАЗ С УРОВНЕМ ГУМОРАЛЬНОГО ИММУННОГО ОТВЕТА ПОСЛЕ ВАКЦИНАЦИИ ПРОТИВ КЛЕЩЕВОГО ЭНЦЕФАЛИТА Аннотация  похожие документы
Н. С. Юдин, А. В. Игошин, С. Л. Лутова, Я. Гон, М. И. Воевода, В. А. Белявская
"... nucleotide polymorphisms (SNPs) located within OAS2 and OAS3 genes, which have been previously associated ..."
 
Том 21, № 4 (2017) Гены и свет: много лет спустя Аннотация  PDF (Rus)  похожие документы
А. О. Рувинский
"... обнаружено, что платиновая мутация вызвана заменой нуклеотида в 17 экзоне гена KIT и приводит к появлению ..."
 
Том 22, № 5 (2018) Генетический полиморфизм тополей Московского региона на основе высокопроизводительного секвенирования ITS-последовательностей Аннотация  похожие документы
Е. В. Борхерт, Г. C. Краснов, Н. Л. Большева, П. Кезимана, O. Ю. Юркевич, О. В. Муравенко, А. В. Кудрявцева, Н. В. Мельникова
"... nucleotide polymorphisms (SNPs) detected in each genotype relative to the reference ITS1 and ITS2 sequences ..."
 
Том 22, № 1 (2018) ЭКСПЕРИМЕНТАЛЬНОЕ ИЗУЧЕНИЕ ВЛИЯНИЯ РЕДКИХ ПОЛИМОРФИЗМОВ ТАТА-БОКСОВ ПРОМОТОРОВ ГЕНОВ HBB, HBD И F9 ЧЕЛОВЕКА НА КИНЕТИКУ ВЗАИМОДЕЙСТВИЯ С ТАТА-СВЯЗЫВАЮЩИМ БЕЛКОМ Аннотация  PDF (Rus)  похожие документы
Е. Б. Шарыпова, И. А. Драчкова, Е. В. Кашина, Д. А. Рассказов, П. М. Пономаренко, М. П. Пономаренко, Н. А. Колчанов, Л. К. Савинкова
"... . In the present work, we investigate the effect of rare not annotated single-nucleotide polymorphisms (SNPs ..."
 
Том 17, № 4/1 (2013) КОМПЬЮТЕРНЫЙ АНАЛИЗ СТРУКТУРЫ ЛИПАЗ БАКТЕРИЙ pода Geobacillus И ВЫЯВЛЕНИЕ МОТИВОВ, ВЛИЯЮЩИХ НА ИХ ТЕРМОСТАБИЛЬНОСТЬ Аннотация  PDF (Rus)  похожие документы
К. Н. Сорокина, М. А. Нуриддинов, А. С. Розанов, В. А. Иванисенко, С. Е. Пельтек
"... are divided into groups with regard to their thermostability. Coordinated amino acid substitutions ..."
 
Том 19, № 1 (2015) Mетаболомный подход к оценке сортовой специфичности семян Brassica napus L. Аннотация  PDF (Rus)  похожие документы
Г. Н. Смоликова, А. Л. Шаварда, И. В. Алексейчук, В. В. Чанцева, С. С. Медведев
"... substances, and 52 of them were unambiguously identified. These compounds included amino acids, organic ..."
 
Том 20, № 2 (2016) Особенности экспериментального планирования при исследовании транскриптомов методами высокопроизводительного секвенирования Аннотация  PDF (Rus)  похожие документы
П. Н. Меньшанов, Н. Н. Дыгало
"... определению всех активно транскрибируемых экзонов, так и (2) к идентификации всех считываемых вариантов ..."
 
Том 18, № 3 (2014) ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ СОРТОВ ЯРОВОЙ МЯГКОЙ ПШЕНИЦЫ ПО АЛЮМОУСТОЙЧИВОСТИ Аннотация  PDF (Rus)  похожие документы
Е. М. Лисицын, О. С. Амунова
"... января 2011 г. показы- вают, что кислые почвы составляют 30,2 млн га, или 35,6 % пашни Российской ..."
 
Том 19, № 4 (2015) Mетаболиты мозга у крыс линий НИСАГ и Вистар Аннотация  PDF (Rus)  похожие документы
О. Б. Шевелев, А. А. Серяпина, А. Л. Маркель, М. П. Мошкин
"... �� glutamic acid; Gln�� glutamine; Tau�� taurine; As��� as�artate; nAA�� n-acetylas�artate; GABA�� gamma ..."
 
Том 16, № 2 (2012) ИЗУЧЕНИЕ ВЗАИМОДЕЙСТВИЯ ТАТА-СВЯЗЫВАЮЩЕГО БЕЛКА ЧЕЛОВЕКА С ТАТА-ЭЛЕМЕНТОМ ПРОМОТОРА ГЕНА NOS2A С ИСПОЛЬЗОВАНИЕМ МЕТОДА ПОВЕРХНОСТНОГО ПЛАЗМОННОГО РЕЗОНАНСА Аннотация  PDF (Rus)  похожие документы
И. А. Драчкова, С. В. Шеховцов, С. Е. Пельтек, П. М. Пономаренко, Т. В. Аршинова, М. П. Пономаренко, Т. И. Меркулова, Л. К. Савинкова, Н. А. Колчанов
"... regulation. It is known that some single nucleotide polymorphisms (SNPs) in the human TATA box and its flanks ..."
 
Том 19, № 1 (2015) Получение удвоенных гаплоидов у видов рода Brassica L. Аннотация  PDF (Rus)  похожие документы
Н. А. Шмыкова, Д. В. Шумилина, Т. П. Супрунова
"... of different growth regulators (ethylene, abscisic acid, and indole acetic acid). Optimal combinations ..."
 
Том 16, № 1 (2012) DELLA-МУТАЦИИ РАСТЕНИЙ НА ПРИМЕРЕ ПШЕНИЦЫ Аннотация  похожие документы
Г. А. Чеботарь, С. В. Чеботарь, Ю. М. Сиволап
"... acid sequences stored in GenBank and to identify mutant and wild type alleles that encode DELLAs ..."
 
Том 18, № 3 (2014) БИОТЕХНОЛОГИЧЕСКИЕ АСПЕКТЫ БИОСИНТЕЗА ЭТАНОЛА ИЗ МИСКАНТУСА Аннотация  PDF (Rus)  похожие документы
О. В. Байбакова, Е. А. Скиба
"... characteristic of acid chemical hydrolyzates. Ethanol biosynthesis from enzymatic Miscanthus cellulose ..."
 
Том 16, № 4/1 (2012) КОМПЬЮТЕРНЫЕ МЕТОДЫ ИССЛЕДОВАНИЯ ТЕРМОСТАБИЛЬНОСТИ БЕЛКОВ И ИХ ПРИМЕНЕНИЕ В БИОЛОГИИ Аннотация  PDF (Rus)  похожие документы
Н. А. Алемасов, Э. С. Фомин
"... in molecular structure flexibility caused by mutated amino acid residues. But using the only structure ..."
 
Том 18, № 1 (2014) «РАЗОРВАННЫЕ» ГЕНЫ И СПЛАЙСИНГ Аннотация  PDF (Rus)  похожие документы
Г. М. Дымшиц, О. В. Саблина
"... » – экзонов и «некодирующих» – интронов. Поскольку в ряде случаев интроны (или их части) оказывались ..."
 
Том 20, № 2 (2016) Влияние вазопрессина на экспрессию генов, кодирующих ключевые ферменты метаболизма гиалуронана интерстициальной ткани, и на концентрирующую функцию почки крыс WAG Аннотация  PDF (Rus)  похожие документы
Л. Н. Иванова, А. В. Бабина, Г. С. Батурина, Л. Е. Каткова
"... , чтобы соответствующие фраг- менты геномной ДНК содержались внутри одного экзона. Effect of vasopressin ..."
 
Том 17, № 2 (2013) ИССЛЕДОВАНИЕ БИОРАЗНООБРАЗИЯ МИКРОВОДОРОСЛЕЙ ЗАПАДНОЙ СИБИРИ ДЛЯ ПРИМЕНЕНИЯ В ПРОЦЕССАХ ПОЛУЧЕНИЯ БИОТОПЛИВА ТРЕТЬЕГО ПОКОЛЕНИЯ Аннотация  PDF (Rus)  похожие документы
А. В. Пилигаев, К. Н. Сорокина, А. В. Брянская, Е. А. Демидов, Р. Г. Кукушкин, Н. А. Колчанов, В. Н. Пармон, С. Е. Пельтек
"... of saturated C16:0 (25 %) and unsaturated fatty acids: C16:2 (16 %) and C18:2 (27 %), thus being promising ..."
 
Том 21, № 2 (2017) Создание триплоидных сортов яблони – приоритетное направление в селекции Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов, Г. А. Седышева, М. А. Макаркина, З. М. Серова
"... years Sugar : acid index Fruit taste, score total sugar, % titratable acids, % P-active ..."
 
Том 19, № 3 (2015) Разработка новых SSR -маркеров к локусам гомеологичных генов WFZP на основе изучения строения и локализации микросателлитов в богатых генами районах хромосом 2AS , 2BS, 2DS мягкой пшеницы Аннотация  PDF (Rus)  похожие документы
О. Б. Добровольская, К. Понт, Ю. Л. Орлов, Ж. Сальс
"... . Nucl. Acids Res. 2004;32:3546-3565. DOI: 10.1093/nar/gkh639 Ganal M.W., Röder M.S. Microsatellite ..."
 
Том 21, № 8 (2017) Взаимодействия белок-ДНК: статистический анализ межатомных контактов в большой и малой бороздках Аннотация  PDF (Rus)  похожие документы
А. А. Анашкина, Е. Н. Кузнецов, А. В. Батяновский, А. А. Урошлев, В. Г. Туманян, Н. Г. Есипова
"... correlation 0.94 and 0.93, respectively), however, nucleic acid atoms forming hydrogen bonds make contacts ..."
 
Том 22, № 2 (2018) Влияние ингибитора гликолиза (2-ДГ) и разобщителя окисления и фосфорилирования (2,4-ДНФ) на метаболиты головного мозга Аннотация  PDF (Rus)  похожие документы
О. Б. Шевелев, М. П. Мошкин
"... (glutamine + glutamate) neurotransmitters over inhibitory ones (gamma-aminobutyric acid), and 2,4 DNP causes ..."
 
Том 22, № 3 (2018) ГЕНЕТИЧЕСКИЕ РЕСУРСЫ РИСА (Oryza sativa L.) С ОКРАШЕННЫМ ПЕРИКАРПОМ ЗЕРНА Аннотация  PDF (Rus)  похожие документы
О. В. Зеленская, Г. Л. Зеленский, Н. В. Остапенко, Н. Г. Туманьян
"... on the content of antioxidant compounds in the varieties of the red- and black-grained rice: phenolic acids ..."
 
Том 19, № 2 (2015) Внутрисуточный ритм секреции глюкокортикоидов и динамика генного ответа Аннотация  PDF (Rus)  похожие документы
В. М. Меркулов, Н. В. Климова, Т. И. Меркулова
"... использованием праймеров на экзон-интронные границы) показало, что оно изменяется в точном соответствии с ..."
 
Том 18, № 4/1 (2014) ВАРИАБЕЛЬНОСТЬ ИНТРОНА ПЛАСТИДНОГО ГЕНА TRNL У ВИДОВ FABOIDEAE (СЕМ. FABACEAE) Аннотация  PDF (Rus)  похожие документы
Е. А. Дьяченко, М. А. Филюшин, Е. П. Пронин, Е. З. Кочиева
"... изменениями последовательности РНК интрона. Границы между экзонами и интроном обычно четко определены на ..."
 
Том 19, № 1 (2015) При царе горохе (Pisum sativum L.): непростая судьба первого генетического объекта Аннотация  PDF (Rus)  похожие документы
О. Э. Костерин
"... -, AFLP-, STS-, CAPS-, sCAPS-, and SNP-markers, as well as methods of reverse genetics including TILLING ..."
 
Том 18, № 3 (2014) СРАВНИТЕЛЬНЫЙ АНАЛИЗ ПОЛНЫХ НУКЛЕОТИДНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ МИТОХОНДРИАЛЬНОЙ ДНК КРЫС ЛИНИЙ WISTAR И OXYS ПИТОМНИКА ЛАБОРАТОРНЫХ ЖИВОТНЫХ ИЦИГ СО РАН Аннотация  PDF (Rus)  похожие документы
Р. А. Максютов, Е. В. Гаврилова, Т. С. Непомнящих, У. Н. Роцкая, П. С. Лощенова, Н. Г. Колосова, О. И. Синицина, С. Н. Щелкунов
"... known nucleotide sequences of rat mitochondrial DNA of rats and that they did not cause amino acid ..."
 
Том 20, № 3 (2016) Механизмы регуляции передачи этиленового сигнала у растений Аннотация  PDF (Rus)  похожие документы
Е. В. Землянская, Н. А. Омельянчук, А. А. Ермаков, В. В. Миронова
"... in agriculture. Ethylene biosynthesis from methionine amino acid and the main points of its signaling pathway ..."
 
Том 17, № 3 (2013) ПРОГРАММЫ, МЕТОДЫ, ПРИЕМЫ СЕЛЕКЦИИ ЯБЛОНИ, ИХ РАЗВИТИЕ И СОВЕРШЕНСТВОВАНИЕ Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов
"... , sugar content no less than 12 %, ascorbic acid content about 30 mg/100 g. The preservation capacity ..."
 
Том 20, № 5 (2016) Генетические маркеры в мясном овцеводстве Аннотация  PDF (Rus)  похожие документы
А. В. Дейкин, М. И. Селионова, А. Ю. Криворучко, Д. В. Коваленко, В. И. Трухачев
"... , инсерции, протяженные делеции и др.); 2) точки SNP (single nucleotide polymorphism – однонуклеотидный по ..."
 
Том 20, № 6 (2016) Эволюция CpG-островов путем тандемных дупликаций Аннотация  PDF (Rus)  похожие документы
В. Н. Бабенко, Ю. Л. Орлов, Ж. Т. Исакова, Д. А. Антонов, М. И. Воевода
"... кассеты экзонов и опосредую- щего специфическую адгезию нейронов. Ген протокадерина (PCDH). На хромосоме 5 ..."
 
Том 18, № 1 (2014) «ПРЯМАЯ» И «ОБРАТНАЯ» ГЕНЕТИКА. ГЕНЕТИКА КОЛИЧЕСТВЕННЫХ ПРИЗНАКОВ Аннотация  PDF (Rus)  похожие документы
Н. М. Белоногова
"... ДНК-микрочипов позво- ляет быстро считывать генотипы так называемых SNP маркеров (Single Nucleotide ..."
 
1 - 100 из 250 результатов 1 2 3 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)