Поиск


Сортировать по:     
 
Выпуск Название
 
Том 17, № 2 (2013) ИЗУЧЕНИЕ АЛЛЕЛЬНОГО РАЗНООБРАЗИЯ ГЕНОВ СИНТЕЗА ЭТИЛЕНА MD-ACS1 И MD-ACO1 В ОТЕЧЕСТВЕННОЙ ГЕНПЛАЗМЕ ЯБЛОНИ Аннотация  PDF (Rus)  похожие документы
И. И. Супрун, С. В. Токмаков
"... The allelic diversity of the Md-ACS1 and Md-ACO1 genes, involved in ethylene biosynthesis ..."
 
Том 18, № 4/1 (2014) ПОЛИМОРФИЗМ ДИКОРАСТУЩИХ ВИДОВ РОДА MALUS MILL. ПО ГЕНУ (MD-EXP-7) БИОСИНТЕЗА ЭКСПАНСИНА Аннотация  PDF (Rus)  похожие документы
Н. И. Савельев, И. Н. Шамшин, Н. Н. Савельева, А. С. Лыжин
"... , in wild Malus species. Eight allelic forms of the gene were identified, and four of them were unique ..."
 
Том 22, № 6 (2018) Полиморфизм генов биосинтеза этилена и экспансина у местных и стародавних сортов яблони (Malus domestica Borkh.) из коллекции генетических ресурсов растений ВИР Аннотация  похожие документы
И. Н. Шамшин, А. В. Шлявас, А. А. Трифонова, К. В. Борис, А. М. Кудрявцев
"... configuration of ethylene and expansin biosynthesis related genes Md-ACS1, Md-ACO1 and Md-Exp7 involved ..."
 
Том 20, № 4 (2016) Применение достижений генетики в селекции плодовых культур: вклад Мичуринского отделения Вавиловского общества генетиков и селекционеров Аннотация  PDF (Rus)  похожие документы
Н. И. Савельев, Н. Н. Савельева
"... -ACS1 and Md-ACO1) and expansin (Md-Exp7) controlling fruit long shelf life and pulp firmness. ..."
 
Том 20, № 3 (2016) Отбор перспективных генотипов яблони на колонновидность и устойчивость к парше с помощью диагностических ДНК-маркеров Аннотация  PDF (Rus)  похожие документы
Н. И. Савельев, А. С. Лыжин, Н. Н. Савельева
"... . Allelic status of the Rvi6 gene was determined with the AL07-SCAR marker mapping at about 0.2 cM from ..."
 
Том 16, № 3 (2012) ОСОБЕННОСТИ ОНТОГЕНЕЗА ЯБЛОНИ И ИНТЕНСИФИКАЦИЯ СЕЛЕКЦИИ Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов
"... Исследования особенностей онтогенеза яблони в связи с интенсификацией селекции во ВНИИСПК ведутся ..."
 
Том 22, № 7 (2018) Аллельная и эпигенетическая вариация ДНК в связи с проявлением гетерозиса в F2 Capsicum annuum L. Аннотация  похожие документы
М. Н. Шаптуренко, С. В. Вакула, Л. А. Тарутина, Т. В. Никитинская, Т. В. Печковская, Л. А. Мишин, Л. В. Хотылева
 
Том 17, № 3 (2013) СЕЛЕКЦИОННАЯ ОЦЕНКА ГЕТЕРОПЛОИДНЫХ СКРЕЩИВАНИЙ ПРИ СОЗДАНИИ ТРИПЛОИДНЫХ СОРТОВ ЯБЛОНИ Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов, Г. А. Седышева, З. М. Серова, Н. Г. Горбачева, С. А. Мельник
"... 40-летняя работа по селекции яблони на полиплоидном уровне показала, что для надежного ..."
 
Том 18, № 3 (2014) ГЕНОФОНД ЯБЛОНИ И СЕЛЕКЦИЯ НА УЛУЧШЕНИЕ БИОХИМИЧЕСКОГО СОСТАВА ПЛОДОВ Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов, М. А. Макаркина, З. М. Серова
"... лет проводилась работа по изучению биохимического состава плодов сортового фонда яблони. Изучено ..."
 
Том 16, № 1 (2012) РАСПРЕДЕЛЕНИЕ АЛЛЕЛЕЙ ГЕНОВ Wx В КОЛЛЕКЦИИ МЯГКОЙ ПШЕНИЦЫ КРАСНОДАРСКОГО НИИСХ им. П.П. ЛУКЬЯНЕНКО Аннотация  PDF (Rus)  похожие документы
М. В. Климушина, Н. И. Гладких, М. Г. Дивашук, Л. А. Беспалова, А. В. Васильев, Г. И. Карлов
"... Molecular marker-based identification of allelic variants of Wx genes has been performed ..."
 
Том 17, № 3 (2013) АЛЛЕЛЬНЫЕ ВАРИАНТЫ WAXY-ГЕНОВ СОРТОВ ПШЕНИЦЫ МЯГКОЙ, ВОЗДЕЛЫВАЕМЫХ В ПЕРМСКОМ КРАЕ И В РЕСПУБЛИКЕ БАШКОРТОСТАН Аннотация  PDF (Rus)  похожие документы
И. В. Бобошина, С. В. Боронникова
"... Molecular marker-based identification of allelic variants of Waxy genes has been performed ..."
 
Том 18, № 4/1 (2014) ИЗУЧЕНИЕ АЛЛЕЛЬНОГО СОСТАВА ГЕНОВ VRN-1 И PPD-1 У РАННЕСПЕЛЫХ И СРЕДНЕРАННИХ СОРТОВ ЯРОВОЙ МЯГКОЙ ПШЕНИЦЫ СИБИРИ Аннотация  PDF (Rus)  похожие документы
И. Е. Лихенко, А. И. Стасюк, А. Б. Щербань, А. Ф. Зырянова, Н. И. Лихенко, Е. А. Салина
"... and wheat // Mol. Genet. Genom. 2005. V. 273. P. 54–65. Iqbal M., Shahzad A., Ahmed I. Allelic ..."
 
Том 19, № 1 (2015) Использование генофонда яблони: источники и доноры хозяйственно полезных признаков Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов
"... новых адаптивных, отвечающих современным требованиям, сортов яблони. Показано, что в селекционных ..."
 
Том 17, № 3 (2013) ПРОГРАММЫ, МЕТОДЫ, ПРИЕМЫ СЕЛЕКЦИИ ЯБЛОНИ, ИХ РАЗВИТИЕ И СОВЕРШЕНСТВОВАНИЕ Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов
"... В статье показано, что на основе многолетнего изучения некоторых особенностей онтогенеза яблони ..."
 
Том 20, № 5 (2016) Генетическое разнообразие трех вирусов яблони, выделенных в Беларуси Аннотация  PDF (Rus)  похожие документы
П. В. Кузмицкая, О. Ю. Урбанович
"... Вирус хлоротической пятнистости листьев яблони (ACLSV), вирус ямчатости древесины яблони (ASPV) и ..."
 
Том 21, № 2 (2017) Создание триплоидных сортов яблони – приоритетное направление в селекции Аннотация  PDF (Rus)  похожие документы
Е. Н. Седов, Г. А. Седышева, М. А. Макаркина, З. М. Серова
"... сортов яблони. Дана краткая характеристика доноров диплоидных гамет, которые выделены среди имеющихся ..."
 
Том 21, № 2 (2017) Реализация генетического потенциала морозостойкости у гибридов яблони разной плоидности Аннотация  PDF (Rus)  похожие документы
Н. Г. Красова, З. Е. Ожерельева, А. М. Галашева
"... форм яблони, полученных во ВНИИСПК, по приоритетным направлениям селекции яблони. Цель работы – оценка ..."
 
Том 20, № 5 (2016) Комплексная оценка исходного материала яблони для селекции на иммунитет и качество плодов Аннотация  PDF (Rus)  похожие документы
Е. В. Ульяновская, Т. Г. Причко, Л. Д. Чалая
"... Представлены результаты многолетнего изучения новых перспективных и районированных сортов яблони ..."
 
Том 20, № 3 (2016) Механизмы регуляции передачи этиленового сигнала у растений Аннотация  PDF (Rus)  похожие документы
Е. В. Землянская, Н. А. Омельянчук, А. А. Ермаков, В. В. Миронова
"... - тельность реакций биосинтеза этилена была определена в ходе изучения этого процесса в тканях плодов яблони ..."
 
Том 18, № 4/2 (2014) HIGH-PERFORMANCE SIMULATIONS OF POPULATION-GENETIC PROCESSES IN BACTERIAL COMMUNITIES USING THE HAPLOID EVOLUTIONARY CONSTRUCTOR SOFTWARE Аннотация  похожие документы
Z. S. Mustafin, Yu. G. Matushkin, S. A. Lashin
"... different allelic combinations (ACs). The total number of ACs in a population characterizes its genetic di ..."
 
Том 22, № 6 (2018) Генетическая изменчивость бурятской и алтайской пород крупного рогатого скота, оцененная на основе анализа полиморфизма генов GH1, GHR и PRL Аннотация  похожие документы
И. В. Лазебная, А. В. Перчун, Б. Б. Лхасаранов, О. Е. Лазебный, Ю. А. Столповский
"... of the breeds has been poorly studied. This paper presents the results of analysis of polymorphisms GH1 (AC ..."
 
Том 19, № 2 (2015) Генетический контроль признаков, связанных с усвоением фосфора у сортов риса (Oryza sativa L.) Аннотация  PDF (Rus)  похожие документы
Ю. К. Гончарова, Е. М. Харитонов
"... , выявляемых в российской генплазме, на группы с высокой вероятностью формирования устойчивости за счет ..."
 
Том 19, № 3 (2015) Формирование ассоциаций генов, контролирующих общий гомеостаз и элементы продуктивности твердой пшеницы (Triticum durum Desf.) Аннотация  PDF (Rus)  похожие документы
П. Н. Мальчиков, М. Г. Мясникова
"... селекции (1989–2013 гг.) формирование генплазмы большинства сортов Самарского НИИСХ проходило на фоне ..."
 
Том 19, № 4 (2015) Эффекты воздействия факторов роста при культивировании in vitro эмбрионов мышей и крыс Аннотация  PDF (Rus)  похожие документы
Е. Ю. Брусенцев, Т. Н. Игонина, И. Н. Рожкова, Д. С. Рагаева, С. Я. Амстиславский
"... In vitro culture of preimplantation embryos of ICR, HT1AN/Icgn, HT1AC/Icgn and C57BL/6J-Ay mouse ..."
 
Том 22, № 1 (2018) РЕЗИСТЕНТНОСТЬ К ВОЗБУДИТЕЛЮ ПИРИКУЛЯРИОЗА И МОРФОБИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ГЕНОТИПОВ КОЛЛЕКЦИИ Oryza sativa L. ИЗ РАЗНЫХ ЭКОЛОГО-ГЕОГРАФИЧЕСКИХ ГРУПП В УСЛОВИЯХ КУБАНСКОЙ ЗОНЫ РИСОСЕЯНИЯ Аннотация  PDF (Rus)  похожие документы
Т. Л. Коротенко, О. А. Брагина, И. И. Супрун, Ж. М. Мухина, Ю. В. Епифанович, А. А. Петрухненко, Т. А. Хорина
"... устойчивость, выделена 51 резистентная форма. Устойчивые формы чаще встречались среди генплазмы из Китая ..."
 
Том 17, № 1 (2013) ИСПОЛЬЗОВАНИЕ АЛЛЕЛЬ-СПЕЦИФИЧНЫХ МАРКЕРОВ ГЕНОВ PPD И VRN ДЛЯ ПРОГНОЗИРОВАНИЯ ПРОДОЛЖИТЕЛЬНОСТИ ВЕГЕТАЦИОННОГО ПЕРИОДА СОРТОВ ЯЧМЕНЯ Аннотация  PDF (Rus)  похожие документы
М. М. Злотина, О. Н. Ковалева, И. Г. Лоскутов, Е. К. Потокина
"... Allelic combinations of the Vrn-H1, Vrn-H2, Vrn-H3, Ppd-H1, and Ppd-H2 genes have been ..."
 
Том 20, № 5 (2016) Генетический контроль устойчивости образцов местного ячменя к ринхоспориозу Аннотация  PDF (Rus)  похожие документы
О. Н. Соболева, Г. С. Коновалова, Е. Е. Радченко
"...  allelic genes for scald resistance, while the gene (or genes) of accession k-31075 from Nepal is allelic ..."
 
Том 22, № 3 (2018) ИДЕНТИФИКАЦИЯ ГЕНА УСТОЙЧИВОСТИ К БУРОЙ РЖАВЧИНЕ Lr34 В СОРТАХ И КОЛЛЕКЦИОННЫХ ОБРАЗЦАХ ОЗИМОЙ МЯГКОЙ ПШЕНИЦЫ АГРАРНОГО НАУЧНОГО ЦЕНТРА «ДОНСКОЙ» Аннотация  PDF (Rus)  похожие документы
Н. Н. Вожжова
"... ) and identiication of the Lr34 gene and its allelic state. The assessment of the allelic state of the Lr34 gene has ..."
 
Том 22, № 6 (2018) SSR-локусы, потенциально ассоциированные с высоким содержанием амилопектина в эндосперме зерна кукурузы Аннотация  PDF (Rus)  похожие документы
С. И. Вакула, О. А. Орловская, Л. В. Хотылева, А. В. Кильчевский
"... different SSR allelic variants. The purpose of this study was to evaluate the effectiveness of using waxy ..."
 
Том 22, № 5 (2018) Тенденция преодоления устойчивости к бурой ржавчине интрогрессивных линий мягкой пшеницы с генетическим материалом Aegilops speltoides Tausch Аннотация  PDF (Rus)  похожие документы
Л. Я. Плотникова, Л. В. Мешкова, Е. И. Гультяева, О. П. Митрофанова, И. Ф. Лапочкина
"... was the monitoring of resistance to leaf rust of Ae. speltoides ac­cessions and introgressive lines and cultivars ..."
 
Том 22, № 8 (2018) Становление щетиночного узора у Drosophila melanogaster: предструктура и комплекс генов achaete-scute Аннотация  похожие документы
Д. П. Фурман, Т. А. Бухарина
"... mechanoreceptors is determined by local expression of two proneural genes, achaete (ac) and scute (sc) belonging ..."
 
Том 20, № 1 (2016) Информативные EST-SSR-маркеры для типирования и внутривидовой дифференциации Brassica oleracea var. capitata L. Аннотация  PDF (Rus)  похожие документы
М. Н. Шаптуренко, Т. В. Печковская, С. И. Вакула, А. В. Якимович, Ю. М. Забара, Л. В. Хотылева
"...  for the information content, allelic frequencies and heterogeneity levels. The effective multiallelic markers (Bo20TR ..."
 
Том 20, № 6 (2016) База данных генов, повышающих устойчивость пшеницы и родственных ей злаков к патогенным грибам Аннотация  PDF (Rus)  похожие документы
О. Г. Смирнова, А. В. Кочетов
"...  are not yet known. In addition, the study of allelic variants of resistance genes is important for better ..."
 
Том 22, № 6 (2018) ДНК-диагностика гена RPV3, определяющего устойчивость винограда к возбудителю милдью Аннотация  похожие документы
Е. Т. Ильницкая, М. В. Макаркина, С. В. Токмаков, Л. Г. Наумова
"... American grape species, and that it was possible to identify the allelic status of the gene using DNA ..."
 
Том 16, № 1 (2012) DELLA-МУТАЦИИ РАСТЕНИЙ НА ПРИМЕРЕ ПШЕНИЦЫ Аннотация  похожие документы
Г. А. Чеботарь, С. В. Чеботарь, Ю. М. Сиволап
"... divided all varieties that have been involved in our investigation into three groups ac- cording ..."
 
Том 16, № 1 (2012) ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ ЛОКУСОВ, ОПРЕДЕЛЯЮЩИХ ХЛЕБОПЕКАРНОЕ КАЧЕСТВО УКРАИНСКИХ СОРТОВ ПШЕНИЦЫ Аннотация  PDF (Rus)  похожие документы
С. В. Чеботарь, Е. М. Благодарова, Е. А. Куракина, И. В. Семенюк, А. М. Полищук, Н. А. Козуб, И. А. Созинов, А. Н. Хохлов, А. И. Рыбалка, Ю. М. Сиволап
"... , as well as the allelic compositions of the Pina-D1 and Pinb-D1 genes, determining grain hardness, and Wx ..."
 
Том 19, № 5 (2015) Определение типа цитоплазмы у растений семейства Капустные (Brassicaceae Burnett) с помощью ДНК маркеров Аннотация  PDF (Rus)  похожие документы
Е. А. Домблидес, А. С. Домблидес, Т. В. Заячковская, Л. Л. Бондарева
"... was the accession of white head cabbage Tekila F1 with a new allelic variant of orf138 gene, which combined the 39 ..."
 
Том 22, № 4 (2018) МОНИТОРИНГ ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ МЕСТНЫХ ПОПУЛЯЦИЙ РОДА Aegilops L. ФЛОРЫ КАЗАХСТАНА Аннотация  похожие документы
Р. Уразалиев, М. Есимбекова, К. Мукин, А. Чиркин, Г. Исмагулова
"... heterozygosity was calculated. For the most informative markers the presence of 5 and 6 respective allelic ..."
 
Том 19, № 5 (2015) Молекулярно-генетические механизмы формирования окраски плодов и семян растений Аннотация  PDF (Rus)  похожие документы
В. Ф. Аджиева, О. Г. Бабак, О. Ю. Шоева, А. В. Кильчевский, Е. К. Хлесткина
"... активации гена биосинтеза этилена ACS2 (Itkin, 2009). Известно, что еще один MADS­box, ген TDR4, действует ..."
 
Том 19, № 3 (2015) Собачий узел: систематический обзор рода Canis и предложения по таксономии Аннотация  похожие документы
В. Динец
"... .M., Aco- sta A.A., Giemsch L., Schmitz R.W., Worthington B., Buikstra J.E., Druzhkova A., Graphodatsky A ..."
 
Том 18, № 4/2 (2014) КОМПЬЮТЕРНЫЙ АНАЛИЗ И ФУНКЦИОНАЛЬНАЯ АННОТАЦИЯ САЙТОВ СВЯЗЫВАНИЯ ТРАНСКРИПЦИОННЫХ ФАКТОРОВ AP2/ERF В ГЕНОМЕ ARABIDOPSIS THALIANA L. Аннотация  PDF (Rus)  похожие документы
О. А. Черных, В. Г. Левицкий, Н. А. Омельянчук, В. В. Миронова
"... ATAAAAAGGTAAGAGCCGCCACATAATATATGTAACCT Nicotiana tabacum Shinshi et al., 1995 ACS3 CTATTACATAGTAAGCCGCCCACCGTATCTCAAAATAG Zhang et al ..."
 
Том 20, № 1 (2016) Скорость роста и продуктивность бройлерного кросса кур с разными полиморфными типами гена миостатина Аннотация  PDF (Rus)  похожие документы
Н. В. Дементьева, О. В. Митрофанова, В. И. Тыщенко, В. П. Терлецкий, А. Ф. Яковлев
"... in productive traits between genotypes in MST2109 were not detected. Analysis of allelic variability by MST2244 ..."
 
Том 20, № 4 (2016) Теоретические аспекты гетерозиса Аннотация  PDF (Rus)  похожие документы
Л. В. Хотылева, А. В. Кильчевский, М. Н. Шаптуренко
"... to linkage and non-allelic genes’ interactions that make nuances to analysis of dominance and over-dominance ..."
 
Том 22, № 7 (2018) Анализ генетической коллекции земляники (Fragaria L.) по генам Rca2 и Rpfl с использованием молекулярных маркеров Аннотация  похожие документы
И. В. Лукъянчук, А. С. Лыжин, И. И. Козлова
"... allelic state Rca2 anthracnose resistance gene the dominant SCAR marker STS-Rca2_240 was used, was linked ..."
 
Том 22, № 7 (2018) Поиск изменений нуклеотидной последовательности гена ремоделирования хроматина PBRM1 у пациентов со светлоклеточным раком почки Аннотация  PDF (Rus)  похожие документы
Е. А. Климентова, И. Р. Гилязова, А. А. Измайлов, И. М. Султанов, М. А. Бермишева, В. Н. Павлов, Э. К. Хуснутдинова
"... (in exon 23). The frequency of detected mutations was 0.95 % of cases. Analysis of the allelic association ..."
 
Том 22, № 7 (2018) Роль полиморфного локуса VNTR гена аггрекана в развитии остеоартроза у женщин Аннотация  PDF (Rus)  похожие документы
Д. А. Шаповалова, А. В. Тюрин, С. С. Литвинов, Э. К. Хуснутдинова, Р. И. Хусаинова
"... of the localization of the pathological process, as well as with the presence of uCTD signs. Twelve allelic variants ..."
 
Том 19, № 5 (2015) Подходы по улучшению качества зерна пшеницы: селекция на число падения Аннотация  PDF (Rus)  похожие документы
В. А. Крупнов, О. В. Крупнова
"... /AC Domain (оба имеют красное зерно) на хромосоме 4B идентифицирована ассоциация QTLs ..."
 
Том 22, № 8 (2018) Получение и изучение линий мягкой пшеницы по озимому сорту Безостая 1 с комбинацией доминантных аллелей локусов VRN-1 Аннотация  похожие документы
Е. В. Чуманова, Т. Т. Ефремова, Ю. В. Кручинина, Л. А. Першина
"... rapid identifcation of allelic spectra in common wheat varieties and lines. The unequal influence ..."
 
Том 20, № 6 (2016) Выявление новых регуляторных SNP, ассоциированных с предрасположенностью к развитию колоректального рака Аннотация  PDF (Rus)  похожие документы
Е. Ю. Леберфарб, Л. О. Брызгалов, И. И. Брусенцов, Т. И. Меркулова
"... ­driven changes in metabolism reveals broad dysregulation of PAFAH1B2 and 1B3 in cancer. ACS Chem. Biol. 2015 ..."
 
Том 19, № 5 (2015) Селекция гибридных форм как стимул развития молекулярно-генетических исследований у ржи Аннотация  PDF (Rus)  похожие документы
Р. Шлегель
"... * The major recessive gene controlling male sterility is allelic with the genes for male sterility of ty�es c ..."
 
Том 18, № 4/1 (2014) КОРРЕЛЯЦИОННЫЙ АНАЛИЗ ЗАВИСИМОСТИ СИЛЫ МУКИ ОТ ЗАПАСНЫХ БЕЛКОВ ПШЕНИЦЫ Аннотация  PDF (Rus)  похожие документы
Л. В. Обухова, Е. Б. Будашкина
"... characteristics // J. Cereal Sci. 1985. V. 3. P. 345–354. Gupta R.B., MacRitchie F. Allelic variation at ..."
 
Том 16, № 3 (2012) ГЕНЕТИЧЕСКИЕ РЕСУРСЫ РАСТЕНИЙ КАЗАХСТАНА: СОСТОЯНИЕ И ПЕРСПЕКТИВЫ Аннотация  PDF (Rus)  похожие документы
Б. Ш. Алимгазинова, М. А. Есимбекова
"... внутривидового разнообразия и одомашнивания яблони и абрикоса. Здесь со- средоточены самые крупные в мире ..."
 
Том 16, № 1 (2012) СЕТЬ ГЕНЕТИЧЕСКИХ РЕСУРСОВ ВО ФРАНЦИИ: СОТРУДНИЧЕСТВО МЕЖДУ ПОЛЬЗОВАТЕЛЯМИ И ЦЕНТР ГЕНЕТИЧЕСКИХ РЕСУРСОВ ЗЕРНОВЫХ КУЛЬТУР Аннотация  похожие документы
А. Дидье, Л. Барди, Э. Була, Ж. Кениг, А. Лапьер, Ф. Эксбрайя, Ж. Бордэ, Ф. Балфурье
"... done on 4 000 accessions to characterize the allelic diversity with 42 microsatellites loci spread ..."
 
Том 19, № 3 (2015) К 160-летию со дня рождения Ивана Владимировича Мичурина Аннотация  PDF (Rus)  похожие документы
Н. П. Гончаров, Н. И. Савельев
"... сортов отбором гибридов из потомств, полученных из гибридных семян яблони, груши, вишни и сливы от ..."
 
Том 18, № 4/2 (2014) ГЕНЫ, КОНТРОЛИРУЮЩИЕ ПИЩЕВОЕ ПОВЕДЕНИЕ И МАССУ ТЕЛА ЧЕЛОВЕКА, И ИХ ФУНКЦИОНАЛЬНЫЕ И ГЕНОМНЫЕ ХАРАКТЕРИСТИКИ Аннотация  PDF (Rus)  похожие документы
Е. В. Игнатьева, Д. А. Афонников, Е. И. Рогаев, Н. А. Колчанов
"... гены двух категорий. К первой, именуемой в дальнейшем OMIM-allelic variant, отнесены 73 гена, имею ..."
 
Том 18, № 3 (2014) МИКРОСАТЕЛЛИТНОЕ ГЕНОТИПИРОВАНИЕ ДОНСКИХ АБОРИГЕННЫХ СОРТОВ ВИНОГРАДА (VITIS VINIFERA L.) Аннотация  PDF (Rus)  похожие документы
Е. Т. Ильницкая, С. В. Токмаков, И. И. Супрун
"... происхождения евразийского культурного винограда (Турок и др., 2006). Так, при исследовании генплазмы ..."
 
Том 16, № 1 (2012) ПРИМЕНЕНИЕ МОЛЕКУЛЯРНЫХ МАРКЕРОВ СЕЛЕКЦИИ ПШЕНИЦЫ В КРАСНОДАРСКОМ НИИСХ ИМ. П.П. ЛУКЬЯНЕНКО Аннотация  PDF (Rus)  похожие документы
Л. А. Беспалова, А. В. Васильев, И. Б. Аблова, В. А. Филобок, Ж. Н. Худокормова, Р. О. Давоян, Э. Р. Давоян, Г. И. Карлов, А. А. Соловьев, М. Г. Дивашук, Н. К. Майер, М. В. Дудников, Н. В. Мироненко, О. А. Баранова
"... гена с прорастанием на фоне генплазмы краснозерной пшеницы мест- ного генофонда, так как изначально ..."
 
Том 19, № 4 (2015) ОТ РЕДАКТОРА Аннотация  PDF (Rus)  похожие документы
М. П. Мошкин
"... , 2015. These articles cover every aspect of CGR ac- tivity, except for transgenesis, for the associated ..."
 
Том 17, № 2 (2013) PR-БЕЛКИ С РИБОНУКЛЕАЗНОЙ АКТИВНОСТЬЮ И УСТОЙЧИВОСТЬ РАСТЕНИЙ К ПАТОГЕННЫМ ГРИБАМ Аннотация  PDF (Rus)  похожие документы
Е. А. Филипенко, А. В. Кочетов, Y. Kanayama, В. И. Малиновский, В. К. Шумный
"... старении листьев (Sikorski et al., 1999). Похожие семейства генов найдены у винограда, березы, яблони и ..."
 
Том 16, № 3 (2012) СБОР И СОХРАНЕНИЕ ГЕНЕТИЧЕСКИХ РЕСУРСОВ РАСТЕНИЙ ДЛЯ ПРОДОВОЛЬСТВИЯ И СЕЛЬСКОГО ХОЗЯЙСТВА ЭСТОНИИ Аннотация  PDF (Rus)  похожие документы
K. Annamaa, В. Кукк
"... ) and the Centre of Ge- netic Resources of the Netherlands. In addition to the material of Estonian origin, ac ..."
 
Том 19, № 4 (2015) Применение репродуктивных технологий и создание криобанка генетических ресурсов лабораторных животных Аннотация  PDF (Rus)  похожие документы
С. Я. Амстиславский, Е. Ю. Брусенцев, Т. О. Абрамова, Д. С. Рагаева, И. Н. Рожкова, Т. Н. Игонина, Е. А. Кизилова, В. А. Напримеров, Н. Ю. Феоктистова
"... � HT1Ac/icgn Stored in the cryoban� GM-3/icgn Stored in the cryoban� GM-�3/icgn Stored ..."
 
Том 18, № 2 (2014) ПРОЦЕССЫ КОЭВОЛЮЦИИ В СИСТЕМЕ «ХИЩНИК–ЖЕРТВА». ЭКОЛОГО-ГЕНЕТИЧЕСКАЯ МОДЕЛЬ Аннотация  PDF (Rus)  похожие документы
Ю. С. Букин
"... вида, личинки которого стали вредителем яблони. Это стало стимулом видообразования у наездников ..."
 
Том 19, № 6 (2015) Современные подходы к математическому и компьютерному моделированию в микробиологии Аннотация  PDF (Rus)  похожие документы
А. И. Клименко, З. С. Мустафин, А. Д. Чеканцев, Р. К. Зудин, Ю. Г. Матушкин, С. А. Лашин
"... microbial bio��lms. ACS Synthetic Biology 2012;1(8): 345-352. DOI 10.1021/sb300031n Salli K.M., Ouwehand A.C ..."
 
Том 19, № 3 (2015) Маркер-контролируемое выявление генотипов кукурузы с улучшенным качеством белка Аннотация  PDF (Rus)  похожие документы
О. А. Орловская, С. В. Кубрак, С. И. Вакула, Л. В. Хотылева, А. В. Кильчевский
"... ., Wu J. Recessive allelic variations of three microsatellite sites within the O2 gene in maize. Plant ..."
 
Том 18, № 4/1 (2014) ПРОМОТОРЫ ГЕНОВ РАСТЕНИЙ, УЧАСТВУЮЩИХ В ЗАЩИТЕ ОТ ПАТОГЕНОВ Аннотация  PDF (Rus)  похожие документы
О. Г. Смирнова, А. В. Кочетов
"... наблюдалась только в колонизированных клетках (Strittmatter et al., 1996). У яблони про- мотор StGst1 ..."
 
Том 21, № 1 (2017) Оценка разнообразия растений и изменчивости транскрипционной активности с использованием молекулярных маркеров на основе ретротранспозонов Аннотация  похожие документы
Р. Н. Календарь, К. С. Айжаркын, О. Н. Хапилина, А. А. Аменов, Д. С. Тагиманова
"... rearrangements can lead to non­ allelic homologous recombination or insertional mutagenesis due to the ‘hopping ..."
 
Том 18, № 4/1 (2014) ГЕНЫ БИОСИНТЕЗА ФЛАВОНОИДОВ ПШЕНИЦЫ Аннотация  PDF (Rus)  похожие документы
Е. К. Хлесткина, О. Ю. Шоева, Е. И. Гордеева
"... allelic variations and their associations with pre-har- vest sprouting resistance in a set of red-grained ..."
 
Том 20, № 6 (2016) Структурное моделирование мод связывания НАД+ с ПАРП-1 Аннотация  PDF (Rus)  похожие документы
Н. В. Иванисенко, Д. А. Жечев, В. А. Иванисенко
"... . Theory Computation. 2015;12(1):281-296. DOI 10.1021/acs.jctc.5b00864. Hay T., Jenkins H., Sansom O ..."
 
Том 19, № 2 (2015) Внутрисуточный ритм секреции глюкокортикоидов и динамика генного ответа Аннотация  PDF (Rus)  похожие документы
В. М. Меркулов, Н. В. Климова, Т. И. Меркулова
"... ., Hardes K., Donald A.C. Efficacy and safety of once-daily GW870086 a novel selective glucocorticoid ..."
 
Том 19, № 3 (2015) Применение репродуктивных технологий для повышения эффективности геномной селекции молочного крупного рогатого скота Аннотация  PDF (Rus)  похожие документы
Н. С. Юдин, К. И. Лукьянов, М. И. Воевода, Н. А. Колчанов
"... A., Sorensen A.C., Juga J. Genomic selection strategies to op- timize the use of multiple ovulation and embryo ..."
 
Том 19, № 3 (2015) Профиль экспрессии длинных и коротких РНК в цитоплазме и ядрах растущих ооцитов домашней курицы (Gallus gallus domesticus) Аннотация  PDF (Rus)  похожие документы
А. В. Красикова, А. В. Федоров
"... стандартный протокол (http://projects.exeter.ac.uk/lampbrush/protocols.htm). Ядра (зародышевые пузырьки ..."
 
Том 19, № 4 (2015) Использование модели половой активации для фенотипирования самцов линий мышей и крыс с закрепленными селекцией нарушениями поведения Аннотация  PDF (Rus)  похожие документы
М. А. Тихонова, Т. Г. Амстиславская
"... ac he s to th e �a rt iti on 15 10 5 0 Te st os te ro ne �� n g/ m l cBA ASc ..."
 
Том 21, № 3 (2017) Различия между некоторыми видами рода Ulva, выявленные путем морфологического, генетического и биохимического анализа Аннотация  похожие документы
М. М. Исмаил, С. Э. Мохамед
"... . f as ci at a Mbp 1000 1000 500 500 300 300 100 100 M MU . l ac tu ca U . l ac tu ca ..."
 
Том 21, № 4 (2017) Когнитивные способности животных (рассудочная деятельность) в свете генетических представлений Аннотация  похожие документы
И. И. Полетаева, О. В. Перепелкина, З. А. Зорина
"... being made invisible). This ability was classified as “cognitive” ac- cording to Piaget concepts ..."
 
Том 18, № 3 (2014) ВКЛАД СЕЛЬСКОХОЗЯЙСТВЕННЫХ ОПЫТНЫХ УЧРЕЖДЕНИЙ КИТАЙСКО-ВОСТОЧНОЙ ЖЕЛЕЗНОЙ ДОРОГИ В ФОРМИРОВАНИЕ КОЛЛЕКЦИИ СОИ ВИР И В РАЗВИТИЕ ЕЕ СЕЛЕКЦИИ В СССР Аннотация  PDF (Rus)  похожие документы
И. В. Сеферова, М. А. Вишнякова
"... , перец, дыня, арбуз), плодовых и орехоплод- ных культур (яблоня, слива, миндаль, лещина), а так-же ..."
 
Том 16, № 3 (2012) ГЕНЕТИЧЕСКИЙ БАНК ХОЗЯЙСТВЕННО ПОЛЕЗНЫХ РАСТЕНИЙ В РЕСПУБЛИКЕ БЕЛАРУСЬ Аннотация  PDF (Rus)  похожие документы
Ф. И. Привалов, С. И. Гриб, И. С. Матыс
"... -П4, ОВС-П6. Для производственного испытания передан перспективный гибрид яблони 1-13. Вы- ращен ..."
 
Том 17, № 4/2 (2013) МОЛЕКУЛЯРНЫЕ МАРКЕРЫ В ГЕНЕТИЧЕСКИХ ИССЛЕДОВАНИЯХ И В СЕЛЕКЦИИ Аннотация  PDF (Rus)  похожие документы
Е. К. Хлесткина
"... ); корова, лошадь, сорго, кукуруза, огурец (2009); кролик, клещевина, какао, соя, яблоня (2010); индейка ..."
 
Том 16, № 1 (2012) КОМБИНАЦИЯ АЛЛЕЛЕЙ ГЕНОВ Ppd И Vrn ОПРЕДЕЛЯЕТ СРОКИ КОЛОШЕНИЯ У СОРТОВ МЯГКОЙ ПШЕНИЦЫ Аннотация  PDF (Rus)  похожие документы
Е. К. Потокина, В. А. Кошкин, Е. А. Алексеева, И. И. Матвиенко, В. А. Филобок, Л. А. Беспалова
"... Acad. Sci. USA. 2003. V. 100. P. 6263–6268. Yan L.D., Helguera M., Kato K. et al. Allelic variation ..."
 
Том 21, № 3 (2017) Эффективность ольфакторного транспорта наночастиц оксида марганца (II) при однократном или многократном интраназальном введении Аннотация  PDF (Rus)  похожие документы
А. В. Ромащенко, М. Б. Шарапова, Д. В. Петровский, М. П. Мошкин
"... localization and dopaminergic neurons damage pathways. ACS Nano. 2011;5(6):4476­4489. Xia S., Xu S. Improved ..."
 
Том 17, № 4/1 (2013) СЕГРЕГАЦИОННЫЕ МОДЕЛИ СЛОЖНЫХ КОЛИЧЕСТВЕННЫХ ПРИЗНАКОВ И АНАЛИЗ СЦЕПЛЕНИЯ В РАСШИРЕННЫХ ДИАЛЛЕЛЬНЫХ СКРЕЩИВАНИЯХ ПАНЕЛИ РЕКОМБИНАНТНЫХ ИНБРЕДНЫХ ЛИНИЙ Аннотация  PDF (Rus)  похожие документы
М. С. Дьяков, А. В. Осадчук
"... . 128. Nо. 3. P. 631–638. Van der Veen J.H. Test of non-allelic interaction and linkage for ..."
 
Том 21, № 2 (2017) Гены сельскохозяйственных растений, модифицированные с помощью системы CRISPR/Cas Аннотация  PDF (Rus)  похожие документы
А. М. Короткова, С. В. Герасимова, В. К. Шумный, Е. К. Хлесткина
"... (1/0), соя (12/6), то­ мат (17/7), фасоль (4/0), хлопок (6/0), яблоня (6/2), ячмень (9/1). При ..."
 
Том 19, № 5 (2015) Противоположные ассоциации мутаций генов HRAS и KRAS с клиническими параметрами рака мочевого пузыря Аннотация  PDF (Rus)  похожие документы
М. П. Смаль, А. И. Ролевич, Т. И. Набебина, С. А. Красный, Р. И. Гончарова
"... .1038/ejhg.2013.251 Boulalas I., Zaravinos A., Karyotis I., Delakas D., Spandidos D.A. Ac­ tivation ..."
 
Том 21, № 4 (2017) Морфометрия и эволюция: проблема пересечения крутых фенотипических ландшафтов прямыми путями Аннотация  похожие документы
П. Д. Полли
"... ic tr ai t 2 Ph en ot yp ic tr ai t 2 environm ental factor 1 en vi ro nm en ta l f ac ..."
 
Том 16, № 3 (2012) ПОЕЗДКА Н. И. ВАВИЛОВА В США И ЗАПАДНУЮ ЕВРОПУ В 1921–1922 гг. Аннотация  PDF (Rus)  похожие документы
Т. Б. Авруцкая
"... , ячменем и овсом. <…> Русские сорта яблонь, груш, черешни заселяют сады Канады» (Вавилов, 1924. С. 109 ..."
 
Том 18, № 3 (2014) ПРИМЕНЕНИЕ ЭЛЕКТРОФОРЕЗА ЗАПАСНЫХ БЕЛКОВ СЕМЯДОЛЕЙ И ISSR-МАРКЕРОВ ДЛЯ ИДЕНТИФИКАЦИИ ГИБРИДОВ МЕЖДУ SORBUS SIBIRICA HEDL. И SORBOCOTONEASTER POZDNJAKOVII POJARK. Аннотация  PDF (Rus)  похожие документы
С. В. Асбаганов, Е. В. Кобозева, А. В. Агафонов
"... ., 2004), то помимо контроля самофертильности проводились скрещивания с яблоней Недзвецкого (Malus ..."
 
Том 16, № 3 (2012) НАЦИОНАЛЬНЫЙ БАНК ГЕНЕТИЧЕСКИХ РЕСУРСОВ РАСТЕНИЙ УКРАИНЫ КАК ВОПЛОЩЕНИЕ ИДЕЙ Н. И. ВАВИЛОВА Аннотация  PDF (Rus)  похожие документы
В. К. Рябчун, Н. В. Кузьмишина, Р. Л. Богуславский
"... Полесья; плодовые культуры – яблони, груши, сливы, алычи, вишни, черешни, винограда из разных регионов и ..."
 
Том 19, № 4 (2015) Сравнение различных сочетаний криопротекторов и методов оттаивания при криоконсервации эмбрионов мышей и крыс Аннотация  PDF (Rus)  похожие документы
Т. Н. Игонина, Е. Ю. Брусенцев, И. Н. Рожкова, В. А. Напримеров, С. Я. Амстиславский
"... -1302. DOI: 10.1095/biolreprod63.5.1294 Rall W.F., Schmidt P.M., Lin X., Brown S.S., Ward A.C., Hansen ..."
 
Том 21, № 3 (2017) Анализ полиморфизма экзона-4 гена VERNALIZATION-A1 у видов полиплоидной пшеницы Аннотация  PDF (Rus)  похожие документы
А. Ф. Мутерко, Е. А. Салина
 
Том 16, № 1 (2012) ВРЕМЯ КОЛОШЕНИЯ ЗАМЕЩЕННЫХ И ИЗОГЕННЫХ ЛИНИЙ МЯГКОЙ ПШЕНИЦЫ С ДОМИНАНТНЫМИ АЛЛЕЛЯМИ Vrn-B1a И Vrn-B1c Аннотация  PDF (Rus)  похожие документы
М. В. Емцева, Т. Т. Ефремова, В. С. Арбузова
"... wheat (supplement) // 2007. Available at: http://shigen.ac.jp/wheat/komugi. McIntosh R.A., Dubcovsky J ..."
 
Том 16, № 4/2 (2012) ПОВЫШЕНИЕ ПРОДУКТИВНОСТИ МЕЖПОДВИДОВЫХ ГИБРИДОВ РИСА Аннотация  PDF (Rus)  похожие документы
Ю. К. Гончарова, Е. М. Харитонов
"... . The evolution of sex-independent transmission ratio distortion involving multiple allelic ..."
 
Том 21, № 2 (2017) Комплексная оценка сортового фонда айвы (Cydonia oblonga Mill.) в условиях Краснодарского края Аннотация  PDF (Rus)  похожие документы
Т. Г. Причко, Л. Д. Чалая, Н. В. Можар
"... семечковых культур, в том числе от яблони, которая в условиях юга России накапливает не более 14.5 мг/100 г ..."
 
Том 20, № 6 (2016) Вычислительные проблемы анализа ошибок коротких прочтений ДНК при секвенировании следующего поколения Аннотация  похожие документы
Р. те Боекхорст, Ф. М. Науменко, Н. Г. Орлова, Э. Р. Галиева, А. М. Спицина, И. В. Чадаева, Ю. Л. Орлов, И. И. Абнизова
"... ; genome polymorphisms; sequencing errors; review. e-mail: ia1@sanger.ac.uk; orlov@bionet ..."
 
Том 19, № 3 (2015) Разработка новых SSR -маркеров к локусам гомеологичных генов WFZP на основе изучения строения и локализации микросателлитов в богатых генами районах хромосом 2AS , 2BS, 2DS мягкой пшеницы Аннотация  PDF (Rus)  похожие документы
О. Б. Добровольская, К. Понт, Ю. Л. Орлов, Ж. Сальс
"... marker potential. Genome Res. 2001;11:1441-1452. DOI: 10.1101/gr.184001 Thuillet A.C., Bru D., David J ..."
 
Том 19, № 4 (2015) Стресс и артериальная гипертония: крысы линии НИСАГ (ISIAH) Аннотация  PDF (Rus)  похожие документы
Е. В. Антонов, Ю. В. Александрович, А. А. Серяпина, Л. О. Климов, А. Л. Маркель
"... - man hypertension: achievements and perspectives. Hypertension. 2009;54:690-697. Guyton A.C. Textbook ..."
 
1 - 100 из 120 результатов 1 2 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)