Preview

Вавиловский журнал генетики и селекции

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 21, № 4 (2017) Когнитивные способности животных (рассудочная деятельность) в свете генетических представлений Аннотация  похожие документы
И. И. Полетаева, О. В. Перепелкина, З. А. Зорина
"... свидетельствуют, что существует тесная связь между способностью мыши к решению когнитивного теста и процессами ..."
 
Том 21, № 3 (2017) Кандидатные антиревматические плазмидные конструкции обладают низкой иммуногенностью Аннотация  PDF (Rus)  похожие документы
Т. С. Непомнящих, Т. В. Трегубчак, С. Н. Якубицкий, О. С. Таранов, Р. А. Максютов, С. Н. Щелкунов
"... . TNF inhibitors such as recombinant receptors or monoclonal antibodies are the most widely used ..."
 
Том 21, № 7 (2017) Влияние нокаута гена Zbtb33 и бактериального липополисахарида на поведение в домашней клетке у мышей Аннотация  PDF (Rus)  похожие документы
Н. В. Хоцкин, И. Е. Сорокин, Е. А. Куликова, А. В. Куликов
"... response to emotional stress in the open field and forced swimming tests has been shown. The aim ..."
 
Том 21, № 7 (2017) Поведенческие и нейрональные реакции на кон- и гетероспецифические обонятельные сигналы у двух видов мышей – Mus musculus и Mus spicilegus Аннотация  PDF (Rus)  похожие документы
Е. В. Котенкова, А. В. Ромащенко, А. Н. Мальцев
"... . In two-choice odor tests males significantly longer investigated odor of conspecific females ..."
 
Том 20, № 6 (2016) Морфофизиологические эффекты инсерционного мутагенеза гена контактин 5 (Cntn5) у трансгенных мышей Аннотация  PDF (Rus)  похожие документы
А. В. Смирнов, Н. А. Феофанова, Г. В. Концевая, М. В. Анисимова, И. И. Ковригин, И. А. Серова, М. П. Мошкин, Л. А. Герлинская, Н. Р. Баттулин
"...  гранулоцит-макрофаг колониестимулирующего фактора человека в молоко в линии мышей (GM9), встройка конструкции ..."
 
Том 21, № 7 (2017) Манипуляции с ранними эмбрионами мыши для создания генетически модифицированных животных Аннотация  PDF (Rus)  похожие документы
А. Н. Кораблев, И. А. Серова, Б. В. Скрябин
"... За последнее время технологии редактирования генома стали более эффективными и доступными. Открытие ..."
 
Том 21, № 6 (2017) Получение индуцированных плюрипотентных стволовых клеток американской норки: протокол Аннотация  PDF (Rus)  похожие документы
И. Е. Пристяжнюк, А. Г. Мензоров
"... ” genes, and teratoma formation test in immunodeficient mice. This protocol allows reliable and efficient ..."
 
Том 21, № 3 (2017) Эффективность ольфакторного транспорта наночастиц оксида марганца (II) при однократном или многократном интраназальном введении Аннотация  PDF (Rus)  похожие документы
А. В. Ромащенко, М. Б. Шарапова, Д. В. Петровский, М. П. Мошкин
"... ольфакторной системы. Согласно полученным данным, накопление MnO-НЧ в обонятельных луковицах мышей снижается ..."
 
Том 20, № 6 (2016) Эффективное получение химерных мышей с использованием новой линии эмбриональных стволовых клеток Аннотация  PDF (Rus)  похожие документы
Г. В. Концевая, Н. А. Феофанова, А. Г. Мензоров, И. Е. Пристяжнюк, А. В. Смирнов, Н. Р. Баттулин, Л. А. Герлинская
"... Для получения трансгенных мышей широко используются эмбриональные стволовые клетки. При инъекции ..."
 
Том 21, № 7 (2017) Ассоциация числа копий эндогенных ретровирусов типа А с гематологическими показателями и полом у мини-свиней Аннотация  похожие документы
Р. Б. Айтназаров, С. В. Никитин, Г. В. Концевая, М. И.  Воевода, Н. С. Юдин
 
Том 21, № 7 (2017) Изменение метаболических показателей и двигательной активности у лабораторных мышей под воздействием микроводорослей (Chlorella vulgaris) Аннотация  PDF (Rus)  похожие документы
Е. Л. Завьялов, Д. В. Петровский, Г. В. Концевая, В. В. Мак, И. П. Уваров, Я. Л. Завьялова, О. А. Рожков
"... мышей линии ICR. Животным из экспериментальной группы на протяжении трех недель вместо воды ..."
 
Том 21, № 5 (2017) Генетические ресурсы цитрусовых культур в России, Украине и Беларуси: хранение и использование Аннотация  PDF (Rus)  похожие документы
Р. В. Кулян, Л. С. Самарина, Р. С. Рахмангулов, И. В. Кикавский, А. И. Алехна
"... , it is necessary to develop advanced test systems for rapid diagnosis of diseases. One more important task ..."
 
Том 21, № 7 (2017) Половые различия молекулярных механизмов чувствительности к инсулину у молодых и взрослых мышей C57BL/6J Аннотация  PDF (Rus)  похожие документы
Т. В. Яковлева, А. Ю. Казанцева, Е. Н. Макарова, Н. М. Бажан
"... . Существуют половые различия в развитии метаболических нарушений: самцы мышей по сравнению с самками более ..."
 
Том 21, № 4 (2017) Влияние экспериментальной доместикации серебристо-черных лисиц (Vulpes vulpes) на вокальное поведение Аннотация  PDF (Rus)  похожие документы
С. С. Гоголева, И. А. Володин, Е. В. Володина, А. В. Харламова, Л. Н. Трут
"... ). Процентные соотношения сравнивали с по мощью критерия χ2 и теста Фишера (Fisher exact test). Результаты ..."
 
Том 20, № 6 (2016) Молекулярно-генетические механизмы взаимодействия процессов ответа клетки на механический стресс и нейронального апоптоза при первичной открытоугольной глаукоме Аннотация  PDF (Rus)  похожие документы
О. В. Сайк, Н. А. Коновалова, П. С. Деменков, Н. В. Иванисенко, Т. В. Иванисенко, Д. Е. Иванощук, О. С. Коновалова, О. А. Подколодная, И. Н. Лаврик, Н. А. Колчанов, В. А. Иванисенко
"... человек в мире. Первичная открыто- угольная глаукома (ПОУГ) занимает одно из первых мест по рас ..."
 
Том 20, № 6 (2016) Практическое руководство по редактированию геномов системой CRISPR/Cas9 Аннотация  PDF (Rus)  похожие документы
А. Г. Мензоров, В. А. Лукьянчикова, А. Н. Кораблев, И. А. Серова, В. С. Фишман
"... - ющаяся с символа «>». Пример: >Test_DNA_1 AATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCT ..."
 
Том 20, № 6 (2016) Аутизм как проявление нарушения молекулярных механизмов регуляции развития и функций синапсов Аннотация  PDF (Rus)  похожие документы
Е. А. Трифонова, Т. М. Хлебодарова, Н. Е. Грунтенко
"... историй и тесты на однояйцевых близнецах показали крайне высокую наследуемость аутизма (в 73–95 ..."
 
Том 21, № 7 (2017) Использование геномных данных в селекции птицы Аннотация  PDF (Rus)  похожие документы
А. Ф. Яковлев, Н. В. Дементьева
"... Новые технологии определения последовательности нуклеотидов ДНК позволили открыть сотни тысяч ..."
 
Том 20, № 6 (2016) Компьютерный анализ совместной локализации сайтов связывания транскрипционных факторов в геноме по данным ChIP-seq Аннотация  PDF (Rus)  похожие документы
А. И. Дергилев, А. М. Спицина, И. В. Чадаева, А. В. Свичкарев, Ф. М. Науменко, Е. В. Кулакова, Э. Р. Галиева, Е. Е. Витяев, М. Чен, Ю. Л. Орлов
"... ). Рассмотрены статистические особенности распределения сайтов связывания транскрипционных факторов в геноме мыши ..."
 
Том 20, № 6 (2016) Зачем нужны коллекции линий клеток Аннотация  PDF (Rus)  похожие документы
А. Г. Мензоров, О. Л. Серов
"... информативный тест для ЭСК и ИПСК человека); способность участвовать в формировании хи­ мерных мышей со вкладом ..."
 
Том 21, № 4 (2017) Доместикация и мозг: сорок лет спустя Аннотация  PDF (Rus)  похожие документы
Н. К. Попова
"... мышей (Bell, Hobson, 1994; Olivier et al., 1995). Было показано (Popova et al., 2005), что доместици ..."
 
Том 21, № 1 (2017) Изменчивость ISSR-маркеров и оценка наследования диагностических признаков у StY-геномных видов Elymus pendulinus, E. brachypodioides и E. vernicosus (Poaceae: Triticeae) Аннотация  PDF (Rus)  похожие документы
Е. В. Кобозева, С. В. Асбаганов, О. В. Дорогина, А. В. Агафонов
"... комбинациях скрещиваний. У всех растений F1 были нормально развитые открытые пыльники, семенная фертильность в ..."
 
Том 21, № 6 (2017) Скрининг сортов и гибридов огурца для выявления источников устойчивости к пероноспорозу Аннотация  PDF (Rus)  похожие документы
Н. Т. Амирханова, А. С. Рсалиев
"... заражения, а также выделить стабильные источники устойчивости огурца к болезни. В открытом грунте изучали ..."
 
Том 21, № 7 (2017) Методические подходы к идентификации эффективных генов, определяющих устойчивость пшеницы к комплексу грибных заболеваний Аннотация  PDF (Rus)  похожие документы
Е. С. Сколотнева, И. Н. Леонова, Е. Ю. Букатич, Е. А. Салина
"... to different types of fungal diseases, which integrates traditional field tests and current genotyping ..."
 
Том 21, № 7 (2017) Магнитно-резонансная спектроскопия нейрометаболитов гиппокампа и стриатума при синдроме посттравматических стрессорных расстройств Аннотация  PDF (Rus)  похожие документы
В. Э. Цейликман, О. Б. Шевелев, Н. В. Хоцкин, А. С. Доценко, Г. В. Концевая, М. С. Лапшин, М. П. Мошкин, М. В.  Комелькова, И. В. Фекличева, О. Б. Цейликман, И. В. Дременков, Е. Л. Завьялов
"... тревожности на основе индивидуальных особенностей поведения в тесте «приподнятый крестообразный лабиринт». У ..."
 
Том 20, № 6 (2016) Оценка трансляционной значимости характеристик нуклеотидной последовательности мРНК млекопитающих на основе данных рибосомного профилирования Аннотация  PDF (Rus)  похожие документы
О. А. Волкова, Ю. В. Кондрахин, Р. Н. Шарипов
"...  характеристик нуклеотидных последовательностей мРНК человека и мыши; выявлена их взаимосвязь с соответствующими ..."
 
Том 21, № 7 (2017) Эффективность ольфакторного транспорта аморфных и кристаллических наночастиц оксидов марганца Аннотация  PDF (Rus)  похожие документы
А. В. Ромащенко, Д. В. Петровский, М. Б. Шарапова, Ю. М. Мошкин, К. Э. Купер, К. Н. Морозова, Е. В. Киселева, М. П. Мошкин
"... половозрелых самцах мышей C57BL/6J, проанализирована эффективность поступления в ольфакторный эпителий (ОЭ) и ..."
 
Том 21, № 6 (2017) Комбинационная способность ЦМС-линий зернового сорго на основе А1, А2, А3, А4, 9Е и М-35-1А типов цитоплазматической мужской стерильности Аннотация  PDF (Rus)  похожие документы
О. П. Кибальник
"... , Pischevoe 35, Volzhskoe 4. The tests were conducted on the experimental field of “Rossorgo” in 2015–2016 ..."
 
Том 20, № 6 (2016) Математическая модель циркадного осциллятора млекопитающих: взаимодействие с системой NAD+/SIRT1 и возрастные изменения экспрессии генов циркадного осциллятора Аннотация  PDF (Rus)  похожие документы
Н. Л. Подколодный, Н. Н. Твердохлеб, О. А. Подколодная
"... осциллятора SCN мыши, созданной J.K. Kim и D.B. Forger (Kim, Forger, 2012), выполнена путем до- бавления в ..."
 
Том 21, № 3 (2017) Некоторые аспекты ассоциации генов с высокими спортивными достижениями Аннотация  PDF (Rus)  похожие документы
И. Б. Моссэ, А. В. Кильчевский, Л. А. Кундас, А. Л. Гончар, С. Л. Минин, К. В. Жур
"... квалификации и генотипов атлетов, который выполнен с использованием функции Fisher.test пакета Stat про ..."
 
Том 21, № 4 (2017) Об отборе лисиц на агрессивность и его коррелированных последствиях Аннотация  PDF (Rus)  похожие документы
Л. Н. Трут, А. В. Харламова, А. В. Владимирова, Ю. Э. Гербек
"... ; –2.0 – когда экспериментатор стоит около открытой клетки и двигает защищенную перчаткой руку по ..."
 
Том 21, № 4 (2017) О природе человека (вслед за Д.К. Беляевым) Аннотация  PDF (Rus)  похожие документы
А. Л. Маркель
"... индивидуумами. Эта гипотеза прове рена с помощью батареи когнитивных тестов, выполненных на взрослых шимпанзе ..."
 
Том 21, № 2 (2017) Синапсис и рекомбинация аутосом и половых хромосом у двух видов крачек (Sternidae, Charadriiformes, Aves) Аннотация  PDF (Rus)  похожие документы
А. П. Лисачев, Л. П. Малиновская, А. В. Друзяка, П. М. Бородин, А. А. Торгашева
"... антителами мыши к белку MLH1 человека (Pharmingen, США) при разведении 1 : 50, антителами человека к бел ..."
 
Том 20, № 6 (2016) Кандидатные SNP-маркеры социального доминирования, способные влиять на сродство ТАТА-связывающего белка к промоторам генов человека Аннотация  PDF (Rus)  похожие документы
И. В. Чадаева, Д. А. Рассказов, Е. Б. Шарыпова, Л. К. Савинкова, П. М. Пономаренко, М. П. Пономаренко
"... al., 2012). В микропопуляциях лабораторной мыши были описаны репродуктивные корреляты социальной ..."
 
Том 21, № 4 (2017) Кошки и собаки, в отличие от их диких сородичей, соблюдают правило Ренша Аннотация  похожие документы
К. Х. Бидау, П. А. Мартинес
"... ). To test for the applicability of Rensch’s rule to the domes- tic breeds we used two methodological ..."
 
Том 21, № 4 (2017) «Синдром одомашнивания» в свете геномных данных Аннотация  похожие документы
А. С. Уилкинс
"... be able to test the two ideas since they make such different genetic predictions. To do these comparisons ..."
 
Том 20, № 5 (2016) От редактора Аннотация  PDF (Rus)  похожие документы
В. К. Шумный
"... мыши Кребс-2. Фундаментальные генетико-селек- ционные исследования в этом номере представлены ..."
 
Том 21, № 4 (2017) Эволюция альтруизма Аннотация  похожие документы
Л. А. Дугаткин
"... et al., 2010). There are a number of different kinds of studies that can be used to test Hamilton ..."
 
Том 20, № 6 (2016) Эволюция CpG-островов путем тандемных дупликаций Аннотация  PDF (Rus)  похожие документы
В. Н. Бабенко, Ю. Л. Орлов, Ж. Т. Исакова, Д. А. Антонов, М. И. Воевода
"... мыши плотность cg динуклеотидов в CGI меньше, чем у человека (Illingworth, Bird, 2009). В геноме ..."
 
Том 21, № 4 (2017) Морфометрия и эволюция: проблема пересечения крутых фенотипических ландшафтов прямыми путями Аннотация  похожие документы
П. Д. Полли
"... analysis is to deduce underlying biologi- cal factors or to test hypotheses about the effects ..."
 
Том 20, № 6 (2016) Методы маркирования клеток для изучения судьбы клеточных поколений Аннотация  PDF (Rus)  похожие документы
А. М. Юнусова, Н. Р. Баттулин
"... ., 1986). Например, инъецировав перок- сидазу в один из бластомеров двуклеточного эмбриона мыши ..."
 
Том 20, № 6 (2016) Вычислительные проблемы анализа ошибок коротких прочтений ДНК при секвенировании следующего поколения Аннотация  похожие документы
Р. те Боекхорст, Ф. М. Науменко, Н. Г. Орлова, Э. Р. Галиева, А. М. Спицина, И. В. Чадаева, Ю. Л. Орлов, И. И. Абнизова
"... tests; for exhaustive literature on assemblers read (Nagarajan, Pop, 2013; Chin et al., 2014; Shang et ..."
 
Том 20, № 6 (2016) Cравнительное изучение репликативных свойств противоопухолевых рекомбинантных вирусов осповакцины на культурах клеток глиобластомы человека U87 и почки мартышки CV-1 Аннотация  PDF (Rus)  похожие документы
Р. А. Максютов, И. В. Колосова, Т. В. Трегубчак, И. А. Разумов, С. Н. Щелкунов
"... ксенотрансплантация мышам линии SCID (Завьялов и др., 2015). Материалы и методы Культуры клеток. В работе ..."
 
Том 21, № 4 (2017) Генетическая линия крыс Крушинского – Молодкиной как уникальная экспериментальная модель судорожных состояний Аннотация  PDF (Rus)  похожие документы
И. И. Полетаева, З. А. Костына, Н. М. Сурина, И. Б. Федотова, З. А. Зорина
"... Вистар (как линия КМ). Известны также линии мышей (Skradski et al., 1998) и хомяков (Barrera-Bailón et ..."
 
Том 21, № 1 (2017) Оценка разнообразия растений и изменчивости транскрипционной активности с использованием молекулярных маркеров на основе ретротранспозонов Аннотация  похожие документы
Р. Н. Календарь, К. С. Айжаркын, О. Н. Хапилина, А. А. Аменов, Д. С. Тагиманова
"... , and DNA transposons in S. lycoper­ sicum. By performing binomial test, probability of miRNA enrichment ..."
 
Том 21, № 4 (2017) Гены и свет: много лет спустя Аннотация  PDF (Rus)  похожие документы
А. О. Рувинский
"... , указывая на вероятную гомологию с ранее описанным у мышей геном W. Теперь, когда ген W идентифицирован ..."
 
Том 21, № 1 (2017) Мобилизация, сохранение и изучение генетических ресурсов культивируемого и дикорастущего картофеля Аннотация  PDF (Rus)  похожие документы
С. Д. Киру, Е. В. Рогозина
"... – Южной Америки, несколько видов которых были открыты к тому времени зарубежными ботаниками, изучавшими ..."
 
Том 21, № 1 (2017) Устойчивость картофеля к вирусам: современное состояние и перспективы Аннотация  PDF (Rus)  похожие документы
С. С. Макарова, В. В. Макаров, М. Э. Тальянский, Н. О. Калинина
"... последовательности. В геноме закодировано восемь открытых рамок трансля­ ции (ОРТ), организованных в два генных ..."
 
Том 20, № 6 (2016) Протокол анализа количественных характеристик опушения листа картофеля Аннотация  PDF (Rus)  похожие документы
А. В. Дорошков, М. А. Генаев, Д. А. Афонников
"... - бражение трихом, искривленных в пространстве. Полевая диафрагма, напротив, должна быть максимально открыта ..."
 
Том 21, № 3 (2017) Генетическое разнообразие видов комплекса Aporrectodea caliginosa на территории России Аннотация  PDF (Rus)  похожие документы
С. В. Шеховцов, Е. В. Голованова, Н. Э. Базарова, Ю. Н. Белова, Д. И. Берман, Е. А. Держинский, М. П. Шашков, С. Е. Пельтек
"... studies? Test­ ing the genetic structure and demographic history in the peregrine earthworm Aporrectodea ..."
 
Том 21, № 3 (2017) Создание нового для мягкой пшеницы генотипа – носителя двух локусов мягкозерности эндосперма Аннотация  PDF (Rus)  похожие документы
А. В. Симонов, А. К. Чистякова, Е. В. Морозова, Л. В. Щукина, А. Бёрнер, Т. А. Пшеничникова
"... полевых и тепличных условиях. Проведены испытания физических свойств теста у линий F6–F8 на альвеографе ..."
 
Том 20, № 6 (2016) Анализ геномного распределения сайтов связывания транскрипционных факторов GAGA и CNC в развитии Drosophila melanogaster Аннотация  PDF (Rus)  похожие документы
И. И. Брусенцов, Д. А. Карагодин, Э. М. Баричева, Т. И. Меркулова
"... ’s exact test) greater than the share of each factor in both cases. НОТ regions STARR-Seq enhancers ..."
 
Том 20, № 6 (2016) Полиморфизм регуляторной области гена LCT в некоторых тюркоязычных популяциях Алтае-Саянского региона Аннотация  PDF (Rus)  похожие документы
И. В. Пилипенко, М. С. Пристяжнюк, В. Ф. Кобзев, М. И. Воевода, А. С. Пилипенко
"... the Chi-square test Parameter Population Kazakhs from Uzbekistan (Heyer et al., 2011) Khakassians ..."
 
Том 21, № 2 (2017) Изменчивость морфометрических признаков хвои на клоновой плантации плюсовых деревьев сосны обыкновенной (Pinus sylvestris L.) Аннотация  PDF (Rus)  похожие документы
Н. Н. Бессчетнова, В. П. Бессчетнов
"... variations among elite trees Trait Fisher test, Fexp The share of factor influence (h2 ± sh2), according ..."
 
Том 21, № 1 (2017) Устойчивость картофеля к карантинным болезням Аннотация  PDF (Rus)  похожие документы
А. В. Хютти, О. Ю. Антонова, Н. В. Мироненко, Т. А. Гавриленко, О. С. Афанасенко
"... ­дифференциаторов. В разных странах тест­сортимент был неодинаковым и различался по но­ менклатурному коду. В начале ..."
 
Том 21, № 3 (2017) Полиморфизм гена холодового рецептора TRPM8 у коренного населения Сибири: возможное адаптивное значение полиморфизма rs11563208 на северо-востоке Азии Аннотация  PDF (Rus)  похожие документы
Б. А. Малярчук, М. В. Деренко
"... региональных выборках оценивали с помощью точного теста Фишера. Для полу- чения медианных сетей гаплотипов ..."
 
Том 21, № 3 (2017) Порядок митохондриальных генов как дополнительный маркер в филогенетических исследованиях насекомых Аннотация  PDF (Rus)  похожие документы
Ф. С. Шарко, А. В. Недолужко, С. М. Расторгуев, С. В. Цыганкова, Е. С. Булыгина, А. А. Полилов, Е. Б. Прохорчук, К. Г. Скрябин
"... последовательности вы­ бранных организмов, которые представлены в открытом доступе. Данный программный продукт ..."
 
Том 20, № 6 (2016) Исследование влияния электромагнитного излучения терагерцового диапазона на протеом экстремофильной археи Halorubrum saccharovorum Аннотация  PDF (Rus)  похожие документы
Т. Н. Горячковская, С. Г. Константинова, И. А. Мещерякова, С. В. Банникова, Е. А. Демидов, А. В. Брянская, М. А. Щеглов, А. И. Семенов, Д. Ю. Ощепков, В. М. Попик, С. Е. Пельтек
"... отверстие. Поворот кругов друг относительно друга регулировал площадь открытого отверстия и, таким образом ..."
 
Том 21, № 1 (2017) Сделать сложное проще: современный инструментарий для редактирования генома растений Аннотация  PDF (Rus)  похожие документы
Н. Е. Злобин, В. В. Терновой, Н. А. Гребенкина, В. В. Таранов
"... время открыто множество других бактери­ альных белков­ортологов Cas9 с аналогичными функция­ ми (Fonfara ..."
 
Том 21, № 2 (2017) Гомеобоксные гены факторов транскрипции WOX в паразитическом растении Monotropa hypopitys на стадии цветения Аннотация  PDF (Rus)  похожие документы
А. В. Щенникова, О. А. Шульга, Е. З. Кочиева, А. В. Белецкий, М. А. Филюшин, Н. В. Равин, К. Г. Скрябин
"... последовательностей анализиро­ вали открытые рамки считывания и транслировали их с помощью программы Clone Manager 7 ..."
 
Том 20, № 6 (2016) Стрессовые системы Escherichia coli и их роль в реакциях на воздействие терагерцового излучения Аннотация  PDF (Rus)  похожие документы
С. Е. Пельтек, Е. В. Демидова, В. М. Попик, Т. Н. Горячковская
"... . coli/pCopA-GFP и E. coli/pEmrR-GFP проводилось дополнительное тести- рование на активацию после ..."
 
Том 21, № 1 (2017) Цитоплазматическая мужская стерильность и перспективы ее использования в селекционно-генетических исследованиях и семеноводстве картофеля Аннотация  PDF (Rus)  похожие документы
И. Н. Анисимова, Т. А. Гавриленко
"... экспрессии проводят тест­ скрещивания с ЦМС­линиями и анализируют растения F1. Этот длительный и трудоемкий ..."
 
Том 21, № 4 (2017) Проблема сохранения генофондов доместицированных животных Аннотация  PDF (Rus)  похожие документы
Ю. А. Столповский, И. А. Захаров-Гезехус
"... популяционных структур (программа Struc- ture v.2.2) стало основой ряда тестов молекулярно-ге- нетической ..."
 
Том 21, № 1 (2017) Межвидовые гибриды картофеля как доноры долговременной устойчивости к патогенам Аннотация  PDF (Rus)  похожие документы
Е. В. Рогозина, Э. Е. Хавкин
"... открытие центров генетического разно- образия привели к революционным изменениям: меж- видовая гибридизация ..."
 
Том 21, № 3 (2017) Анализ полиморфизма экзона-4 гена VERNALIZATION-A1 у видов полиплоидной пшеницы Аннотация  PDF (Rus)  похожие документы
А. Ф. Мутерко, Е. А. Салина
"... открытом доступе нуклеотидных последова- тельностей большинства известных аллелей гена VRN-A1, в том ..."
 
1 - 71 из 71 результатов

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)